Description :
From Genome Similarity Track
Location :
Scaffold_460:696- 2692
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_460-snap-gene-0.7DNA2-like helicase

Sequence
1996 bases(100 bases per row)
CCAGGACGACGACACCGCCATGCCGGAGACCAAGATCGTGTGGAAGGACTCACCCGTCGAGAAGCAGATCAAAGTGTCGGGCACGGGAAAGTAAGCAAGA
GAGACCAGGAGCTGCATTGCGTGGATCGCGCGTTGCGTTACCATTGTGCTCATGCTCGCATTTGTTGGACTTGTGTGTGTGTTCATGTGCGACTATACAG
GCTGGCAGTGCGGAAAGAGATGCAAGGCTTTGTCGGCAGACTGGCGCGCGCGAGTATCGAGTCCTCTCATCACAGCGCTGGCGCGTCCGAGTTGTCGAGC
TCCCCGCCCGATCGCCACAGTCGGGACCATTTATTTAGCCACACGTTTACGAAGCGAAAAACTGCTGCAGCGCATGGAAGCGATAGTAGCAATACGCCTG
CAGCGGCTCGAGGCTCTTCCAGTGCAGATGAAGAAGGTACGTACTGTTATGTTATATGTGTGTATGTGTTTGTATCGAGATGGTGTCACCTGAGCGAATG
TCGTCTGTGTATTGGTTTGGTGTCAGGACGAACCCTAGCAGGCGGCATCAATAGAGGCGCGAGTGCAGACACAGGTATAGACAGGATCATTTGGTGGTAT
GTCGATTTACTGGTGCTTGTATGATTCTGATCTAAATATTTGTGTTTTGTGTGTGTTGGATACTTCTTGTTCTTCTCCTGAGCAGCCATTTCTAGGCATT
TACTATTTAGTCCTGAGACAACTCTGAGGCGAACAAACATGGGGACGCCACCACGACACAATGCACCACTCTTATCATCAATGAAAGACAACAGCGCACA
GCATCACGCACCGCCGAACAGCAGTTCAAGCCCCGTTCCTAAAAGCGATTCACAGGACGAACTGCTCATGATACTAGACAAGGTGAGCTCTTTTTGCACC
TCAACACTGTTCCGTTGCTCTATGCGAACTCACTCGTGTGTGTGTGTATCTGACTCTTTCTTGGTAGATTGATGAGAAGTACTCATCCCAGGAAGGCGAT
TTATCAGGACCAGAACCTATGCAGCCGATTCCAGTATCGAGCTCAACGACGCCAAGTAGGGTAGCATCCTCTGCATCTCGTGTTGTTGCTGTTGATGTTG
CAACACCACCGCATACCGCTCAGTCTCTGGTCTCATCAACGACGTCCAACGGATCAGCTGGCAGGGCACAGGCTCTGCAATGCTCTACACCCGAGAGGAA
CATCTCCGCTCAGATTACCCCTGCGGTCATCCAAGAATCGCCAGAGTGTGGTAGTCCGCTGACAGAGGAATCATGGGATCTGCTGGACCAGCTGGAGTTT
CAAGCAACACAACGTATCGCGGCGTCGCAGGATACTGAATGCTCGCAAGCTCAAGTTCAGGTTAATCCGCCTCCTCCATCGCGCTCTCATGTTCCTTCTA
CTAACCAGAACTCTTGGAATCTACCTCCAGTATCACCACGCACGCCATCGAATCAAGTGGTGGTAGGCAATCAAGCGAGAAGAGCTGACCAGCAGCATCA
GCAGAACGGTGATCAAGATGACTTCAAGCGCTTTCTGGTACTTGAAGTAGACTGCGATATGTACAACCGACGACTGATATTGAGACTTCTAGATGACTAT
GACAAGCATGTGGAGGCTGTGCTAGCTGACGACTGGTTCGACAGCATGATCGAGGCTGGGGACACGATCAACATCGTTTTCACCGAGCGAGATCGCGTTG
GCTTCTTCTCTCAAGATGTGGCGAACCGCAGCACCCGCCATCCCTCTCTGCCGAGCATTGTACAAGTTGACAACGAGCAGAACATCATTATCCTGCATCC
AGACGTGCTGGTACGTTTATCGCAATTCAGCTTAAAAGCGTCTACTCTACCTGCGGTGAAAGAAGTTCTGACTGATAATAACGTCATGCATTGAGCAGGT
GTCCCCAACAAGCGTCACAACCAGTTTCAGCTGCTTGCGACGAGCGATTTTGCGTGAAACGCTGAATGTAAATCGCCCAACGCACCAAAAAGCATT