Description :
From Genome Similarity Track
Location :
Scaffold_805:696- 1935
Sequence
1239 bases(100 bases per row)
GTCGTCGGCTGGCTCGGTGATCGCGAAGCCTTACAAGCCGAGCATTCACTCGGTGATCTGCGCCTGAAAGTCTGCGACGACGCTTGGACCGAAGACCGTT
TGTGCTATGTCAACGTACGCGAAGGTTGCAGTTCGTATGACATCGGGCGACGCCCGACGCAAGCTGAGTGGGATCAGCATATTGTCGAGTATCCGCTCAT
GCCGACCGAACACGCTTGAATCGAGAAGTATAAGCGCTCACTCTCCGAGTTCACCCAAGCGGCTATTCGCGCCGACAGCGTTCGCGACGGAGCCCGTCTC
CTGCGCATTCGACGTCTCGAAGGGCACGTAGTCGATCGCGTTCTCGATCGCCGCGAGGTCGCTCGCGGCCGCGTTTGACTCGAGGCTGGAGTCGTAGTCG
TGGACGACATCAGGAACGTCACGAACCAAGTTGGCGCGAGGCTCCCACGTATCATCAGCAGGTTGAAACCCGAGCCATCGTACCTTATACTTCCGCGCGG
CGGGAGCCGCGTGTTGAGCTGACGACTTGGTCGAGTGACGCGCGCGGGGAGGATCTTCGTGATCAACAATACGGTCCACAATCCAGCACGTATCTCCATT
CGAGTCAACGATGGGCGGGGGACCGTCGCGGTGGAATTCGACGCGACCTGGTTGACCAGGACGACGTTGAGCAGGCGCTGAACACTTCTCGGGACGCACA
GGAGGAGGCCGAGCGGGCGGCTGAGAGCTCTCGGAACGCCGAGGCGACGGCGAGTAGTCTGCGGCAGTCGAATCGTGAGCTCTTGCAGCGGCTGCGTAGT
CTGGAGGCGCAGGTGTTTGGCGGACCGAGGGGTGGAGCTCTTCCGCGCGAGCGGGGAACTGGGACAGATGGGACGCTGGCTCGACAGGCTCATCGCGAGG
GCCGCTCAACGCATGCTCCTGCTCCGCCTCCGGGCATCATCGCGGGAAGATACTTCATAAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN