Description :
From Genome Similarity Track
Location :
Scaffold_26:695904- 696909
Transcript NameFunction/comments
Phyca_LT15345478543-hydroxyisobutyrate dehydrogenase, putative

Sequence
1005 bases(100 bases per row)
ccttgactgcgacatacagctggttggcgagggcgagaccaggaagcgacaagttcatgctgttcacagaaaatagtgaaaccaattagcaagcacgaat
tgagcgagcagtgaaattccttaccgttcagcctccttcaacgcgatgcccatgtctttgacgaagtgctccacgaagaaaccagggtcgaagttgcgct
gcgcaattcgtggtccaagattgctaatcgaccaggagccggcagcaccagcactcacagcacgaatagcttcctccacgtccaggccactcttctgggc
atacagtagaccctcaaccacaccaatcatgttcgtggcaatgagaatctgattcaccatcttggtgtgctgaccagctccagcaccgcccatgtgacga
atgttcttgcccatgatctcgaacagcggcatcgtcgactccacggtgttggagtcgccaccgaccatgatcgacagcgttccctcacgagcaccgacat
caccacctgagacaggggcatccagactcgatactcccttcagcttcgctgcctcgtagatctccttggccagcgacggctcgctcgtagtcatatcgac
gatgacgccgccctgtttaatggaggacaacacaccccactccgggtcaagaaacaccttgcgcacatcacttgggtagcccacgatgccgaacacaata
tctagacacaatatgtgtgttaagaaccaaaactactggaactaaggcacagcagcagcgaaacttaccggacaccttcgccacctcggcgggagagctg
gcaacactcgcgccctgctcctttagactgtcgcacttggacagcgtacggttgaacacagtcacctcgtaaccgtgcttctactcgatcaaaatgcaga
caaatgttaatcaagagcatcgagtcatgcccattctgcagacacttaccaaaatgtggccaaccatactggcgcccataactcccgttccaatccatcc
aactc