Description :
From Genome Similarity Track
Location :
Scaffold_433:6959- 11050
Transcript NameFunction/comments
Hyaar_Emoy2814120hypothetical protein

Sequence
4091 bases(100 bases per row)
GCAGATACTTGGAGGCATCTTCGGCTATGGTCCATGCTGGGAGTCTCCATACTATAGCACTACAACTCCACCTCCTTGCTTAGTACGGGCTGACCTATAA
AACTCATTTACGTACAGCTCTTCGCTGGATCCTCGGTGGGGTAGGCAGGTCGATCGTCGGCATTGCCTGCTTTGTAGGGGCAATAGTCGACAGTATTGAG
TCTACACTCTCTCGAAGGGTAATACTGGCTGCCAACGCCCCCCCTCGCACCTGCTCTTCACTTTTTTACACAGCTCACGAACTCCAAGGTCCACTGAGAG
CGGCTCAATTTCCCAAGCGCCCCTTCAAATTGGCAGATTTTACTAATTTTGCTAATCGAATGTCATTTCAAGAACTCGAGGGGTTGGATGACCAACATGA
TGACACAGGTCTCCATTATGCGTAACAAGGCTAATACTTCTTTCTCCTCAGTACTGCCATATATTTGATTAGCCTTGAGGGTAATCTTATAAAAGTCACC
GGCATAAGTAGTACTTCGTAATCCTGTACTTGTGACACCCAAATGTTCCATTCACTTGCATAGAAAATAATGACGGCTTGTCTGGTCGAGTTGAAGTGTC
TCAGAATTGGTGCCGTGGCAATTTATTCTTGAGTATAGCGAAGGCTACTTGAACACGGGTCCACCTTTCTTCGTTTTCGTCTTGGGTGGTGGTATTTTTA
TCCCGCTTAAACTGGCTTCGCCCCGTATGGAAATCCATCTCCTATATAATTCGTAGAGAATAGACGCATACACGGCGTAGTCTTCAATATAGGTGCGATG
ATAAATTAACCTTCCCAAAAAAGATTACATGGCCTTCAGTGTCATTGGCAAGCGTAGGTCGAACCGAGATTGAATGCTCTTCGAATGTGCCTCCAGTCCT
CCACTAAACACTCGAAGCCCAAGGTAGTCGACCTTCCGGCATCCCCACGAACTCTTCACTGCGGTGATCGACAAATTCTAGTAGTCGCACACATCCAACA
CACATTTCATCTTTGTGCACAACGCATCCCATGATTTGGCGGAGATCAGAATGTCATCTTTATATGACCGTCGACCCAGGATCGAGGAACTCGACTGCGC
GTCTGGCTCTCCCACCTCGAACAAATGCTCCGACCTGTTTGTCTCTACGCTTTAGGAAATTCGTAAAAACCATATAGAGCATTATCCAAGAGTGGCTGGT
ATATTTGGGGCGCGTCCTTGAGCCCAAATAGAATCCGCATCCATTCAAACAAACCCAGTGGGATAATGAACGCTGAAATTAGTCTCGCCCTTTCAGTCAT
ACGAACTACCCGATAACCACCCGCCATGTCCAGCGAGCAATACCATAATGGCTTGTACAGGTCTTCACATAGTACATTAATCAGAGGCATAGGATAGACC
ATAAGTTCAGTCAGGTCATTCACCAACCTGTAGTCGATGCACGGCCTAATGTCTACCCCATTTTTCGTCACAACAAAAACGATTGGGCTAGCCCAGGGCG
AGTTAGAAGATTGTATAATATTCTTAGATGACAGCCCCTTGATCAGGTCGGCAAACCTCTCCTTCAATTAGGGGGCTACTTTCCGTACGCGTTGCGCGAT
CGGATTTGAATTTCCTACGTCGATGTCACATATAGCCCTTTGGGTGACCGGCGGTAAGGCATTCTTTTTCTCCATCAACAGATGTCGTCTCTTCCAGATA
ATCTGCCGAATCCGATCCACCTCGTCTGGAGTGGTTTCATTCGGATCAGGAATCTGTATATGTTTTAACCCGATAGTTTCAGAGGAGGGGCCCACTTTCG
ATATGGTTGCCCATCCTCGGTTTATTTCTTCGGCCAAAGGTCTCCACTTTTTAGCGTGCACACTTGTTCATCGTCATGTAGTAATTCTCTGACCTTGGTT
TCCACTTCATCGACTGCGATCTCGACCGATGGATCGGCTTTGGGACCACTTCTTTCTTGAGGGATTTCTTCTTGTAGAGGCACCACTTCAATGCGATGTG
GTCTTATACTGTGGGGTTTCCACCAGTGGTGCCTCGGCTCCCTTCTCAAGCTCAGCTTGAGGGTCAATTTTATCGGGTGGATTCATACGCCAGATTCATC
CACTCAGCGTACCTTTTAAAGACCACCACGACGAATCCTTGTGTTCTTGGTACTTTATCCTTCGTCTGTCACATTTCCTATCTTGGTATCGTCATGTAAT
AGCAACGTGTGGGATCTGACGTTTGTCACGTTCAACAATTATCGGTATCCTATCCCCTGGGTCATAATGTAACCCATTGCTATCCACTTGTGACCAAAAT
TCTCGATTGTTCTGAGGTCCACCCACCTACCTGCAAGTATACAGGCATATTGTCCCACCTTCACGTGTAATACTAGCTTATAGTAGACGGTCCCTCGTCC
GGAAAATCGTATCCGGACTTCGTCAGCGAGGCAGAGTGTTCCATTCGTCAAGTCTAGCCGGATACCAGCCGGGACCATGAAGTTCATCCCTAATATCGAT
CCCTGACCCACTATAGGGCCTACCCACGCCTTAATATCGTACACTAAATTGCCATTTAGGGTGACTTCGGCCTGAGTGCACCCTTCCGTAGAGTATACCG
ATTCCCCAATACCTATACACTCTTGTCTTCGCTTTCGTCAATTTGGCAGCCTACCTAATGAGCAAAAGTGACATCTAAAATAGATATCTTAGCGCCAGTA
TCGAACAACAAATTTGCGCGACCTTTCTTGATCTGTCCAGAGCGTTTGGCTTGTTTAAACTGCTTAGTGGGTGCATGGTATTTCCAGTATCCAATGGGTC
TCCAGGCAGTAGTTCCAACTCCATCACTGCATTTTCTTGGGCAAAATCATTAATTTCATTGAGACAGGACAACATGTACCACAGGGCATTTTCCAAGCTT
CGATATATTATCGGTCTTCTCAGTAAAAAACCCTCTCTCCTCCTTGGGCTGCTTTTCCGCATTTGCGAAGATACAAAAACTAAAGCGTTCGACTCTTAAC
AGATTCAAACCTGGCGAGCGTTCTAATTCATATCTTCTCAGTTACTCCGGCAACATTCCGGCGTACTTAATGGGGATGTACCATTGACGATTCGAATTGT
GGAAGTCCTCTAGATGGCACTACCCCGCTTCGTGGGTCTCTCCGCATCCTTGGCACACTAACAAACAGCGATCTGATGGGTGCCCGTTCTTCCCACTGCG
GTTGCAGGACATTCTCTTCCAGCATCTCAAATCTCCATGTTTCCTGATATGCTGTGGGCACATCTCAAATTTGACTCGGCCGACGTATTGCGGGTTCCTC
GGTCTTCTGCTTGTTTGCGATGCTGGTCGAACTCTCTGGTGGGTCGTTCCTTAATGGTTCTTGTATTTTGGTATCTTTCTGCTTCCTCTGGATAGACCTG
CCTCAGGTCTTCCTCGTTATCCGGATTATCCAAGCTGGACCCCTTCGAGCTCAACTCTTCCGGAAGCGCTCGGACCGCATGTACAGAACGGCGGTTGATA
CCTCTACGTCGACCAGGAGGGACGAGCACCTTTTGTCGGCACTTTCTCGAGCCAAACCGTGTGTTGCCACGCGGCTCCTTCGTTCTCAAACGCGCCTTCA
ACACTTCCTCCAGTTCTTCCACATATGCCAGACGTAGCATCGTCAATTGGTCAGCCAACTCTGGGTCGTCCACGGTCTCGATGTAATTCTCTACATGTTC
CTTCTGAATTTTAAACGATCCACATTTATTTCCAATGCCCTAAGAGCTATCACATTCATGCGGCACAGATAGTCCAACTGGGATTCACCTGACCTCTTCT
TCGCGTGGTAGTACCGGTGAGCAACTGGTATCCCCAGTCCACAGAACTGCATCTGGAATTTGTGTAGCAGGTCTTTCTAAAATCTCCGAACGGAGCGACC
CAGTTGACGATACCAGGTCTGAGCTGGTCAGGTCAACAGTTCTGCGAAGACAAGACACCTTTCGCTGTCCGGTGCTTGGTACCTTGGGAAGGACGTCTTC
AACGTGGTCCTCCACTTGCGTGCTCGGTCCTCGTCCAGATCTCGACCACTGAACCCTTTGAGATCCGAAGTTGCTGAGATCTTGGTGCGGG