Description :
From Genome Similarity Track
Location :
Scaffold_6:69580- 70688
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.46Cyclin-H
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.65GJ14326

Sequence
1108 bases(100 bases per row)
TGGGCTTTGTTGATGACTTCCGCGGCTTCAGCAAAGCCCAGGGGCGTGATCTCCCACTGGACACGCTTCAAAAGCTGCACGCTAACTCGTGTGTTGTTGT
GAACGACTTGCTTCTCACTGAACTACCACTGTGCACGTTTCCAGCGTTCTTGTCTCTCGCTGCATTGTGCCAAGTGGCACAGGAAATGGAGAGCGACCCT
CAAAGCGGGGTGACCAAAAGTGCTGTGCTTGAGTACATCAAACGAAGCAAGTTCGCCCAGGGCCAAGATCTAAATGCGGTACACGAGAAGCTGGACGTAG
TACTGAAACGCTACATGGAATTCAAAGACACGCAGAAGTCACGTGAGCAGGATCCGGTTGTATCGGAGAAGCACGCCAAGCAGATCAAAAAGATCTACAA
GAAACTGAAGGCGCTCCACGTCGAGGAGGATGGAAAGAAAGACAAAGACGGCAAGAAGAGGAAATCCGACGGAGACAAGGATGGAGACAAGAAAGAGAAG
AAGAAGAGCAAGAAAGAGAAGAAAGACAAGAAGTAGTACACAGACAACCGGATTTAAATaCATCACGCCTTCAAGTCTCTATTACTCCTCGTTTCGCTCT
TCTTCTTCTTCCTCCTCCTCCTCTTCCTCCTCTTCGTCCTCGTCATCCTCTTCCTGCTGCTCTGCTGCCATTTTTTCTCCTGAGAAGGAACACATTATGC
TGTCATCGAACAAGCCATTGTCATCAACGTCAATCATCACGTACTCAAGACCTCAACAATCGCGTGTTGTGTGCGGCGTTCCAACTTCTTGAGCATCGGC
GCGATGTCGCGTTCAATGTCCCAATTGGCACGCTTCGGGGCCAGATTCAACACGTCTTCTTCGTCATCTTCTGCCTCGCCTTCCATGGCGGCATCCGTCT
CTGGTTGCTGATGCTCGGCGTCAGCATCTGTGCTCTCGTCGTCCTCTGTTGCCGCCTCTTGAGTCTTTCCGGTATCTTCCTCAGCCACACTCACGGCCAC
AGGCGCGTCTACGACTTCTCCGCGCTCCATTTTTTCCTTGCGCTCCTTCGCCTCGCGCAGCATCTTGAGCCGCTTAGCGCGCGGCATCTCTTCCTCGTGC
TCCGCCAT