Description :
From Genome Similarity Track
Location :
Scaffold_186:69570- 70812
Sequence
1242 bases(100 bases per row)
CGCACGAGTGCGTGAAGCCGTTAGCATAAATTGGTGAGATTCTCGTAGAGGCGTGTACAGAGTTATTCAAACCAACTAAACAACTGGAATCATTGAGCTA
CAATGCCTAAGCGCATCAGCACATACACTGCAGAAGATATTTTTATAAACGTTATTGACGCGCTCTGTTTGGCCATCGATCTGCGAATGCATAGACGTGT
ATATGTTAGAACGGGTGCCAACCATTTGAAAGATGAACTTCCAAAACTAACTCATAAACCGAGGGTCTTGATCAGAGACAATGTTCACAGTCAGAATGTG
TCGTCAAAACACTCGATCAAGAAAAATCTGAGCTGTACCTTCATCATCAATTGCGTCTTGTGCATTCACTAAGTGAGACATCCATCCATTTTGCTCAAGC
GGTCAACCGTGACCACAATACCAGTTTTGTCATCAAAAAAATAAGAATGGACTCCCAATACCTCGTGTATACAAGTTGAATGTATAGTATCGTAGCCGCA
CGTGAGAAGCGTTTTTAACGCTGAAACGTCTCGCATGTGCTCACATATGTACCCAGCCGTTTAGAGTTTGGCCCCCCAGTACCTCTGCCTCACTGAGTAA
TAAATCTCCTCACGACCACAATAACCGCCCAACGAGGTGTCATTTGCCTCGAAAGGATCTGATCCTTTAATTTCTTAACACGAGGAGTAACAATACGAGG
AGTGTACTCAATTTCTGTGCAATAGCACAAAATACATTGATTATAATCGGTGATGGATTCTAGAACGCAAGCGTGTCGAAATTTTTAAGTCGGAGTCTTT
TTAACGCCTCTCTCCGTAAACACGTAACAAAGCTACATAATGATCGTCACAGATATAGACCGCACCAATCAAGTCCAAAATGAACGGCGACAAGTCTATA
CATGATCAAGCTCATAATTTAGTCCTGCTTGACAGCGCATCCATCGTTATGCTTTACTACCTTTAATTTCGCCTTGAAGCTATATTTCGCAAAGAATGAT
AGCCCACAATCCATTCTATCTATGAGAGTATGTGACTGAGTTGCAGTGTGCGCTTGTTCATGATCGGTGTCAACTAGAAACGGCTTCTAGCCAGTAAAAT
ACATTCTGAATGTGATTAGAGCATACTTCATAGGAATTAGCTCCTTGATATGAGCTGGAATGTTTGTCAGCAGCTTTCAGCTGGCAAGATGTATAGGCAC
TGACACGCTCACTTCCTTCAGTATTTGTGTGTAACAGAGCAC