Description :
From Genome Similarity Track
Location :
scaffold_3:69547- 72614
Transcript NameFunction/comments
Pl_112961hypothetical protein PHYSODRAFT_360129

Sequence
3067 bases(100 bases per row)
TTTACAACACCCTTGGCGAAGCACACGCGGAATGCACGCACTTCAATCGCCTGTAGCGTCACTGACGTTCCCTTCACAGGCAACGAACGAGGAGACCAGC
CATAAGTGTCGTCCGTCGTCTTCCACTCCATCCCGCCGACACCTTCCTCCTCCAGAGACAACTCCTTCGTACCAGTCAACACCAATTCCGTCACTTCCGA
CACAACCGAGTTCTTCACAGAGAACAGTGCAGAGAAATCCACCGTCACAGCTTTCGACAGCGTCGGGTGCTCGTCCACAGCATACAAATGCGACAGACGC
ACCATCAAGCACTGCTTCGACAACTCCTGTAGCGTCGTCAGACCCACGTTGACAGGGAACTCACCCACCATCAACCACGGCACCTTCGCTCTCACCTCTG
ACGGAACGGGTTTGCGGTACACCGTCAGCGGACGGAAGAACTGCGACTCCATCTTCGACCGGATGCTGCGCATGCCGTCCTCGGCAGAGTCCACGTTGAT
GAAGAAGTTGCCACGCACCACCAGACCCTTCGTCACGTGCTGCTTCGTGTTCACGTCGTACACGGACTCCGTCTCATTTAGGTGTTCGCCAACTCCTTTG
TTATCATCCGCTAGCAAACGACGGTGAACCATCACCTCAAGCTGACCGTCCATCAAACTCGCTGCTCCCTGCGCGCGGTCTGTCACCACGTTCAGCTGGC
GCTTCGTGTCCTTGATGTACGCTCCGGTGGTGATAGGAAAGTAGTTGGCTGCCACCGCCTCCTGGTTGTCGTGCAAACTCAGGTTCCACGTGTCGCGATG
GTTGCGCACGCGTTTCATGAACTCGAGTCCGTTCGAGTCCGTGTATAGTGTGGCGTCCGACGCGATGTGCTCACCAGCATCGAAGCGCACGATCACCTCC
TTTCCCTTCTTGTCGTCGATGGGGACGGGTCCGACAGTCCACTCGATCTCCAGAAACTCATCATCATCATTCACGCGGTATTCGAGCGTGACCCAGCTAC
CGATCTTGAACGCCACACGCGGCACACTCGTAACACCACCGTTAGCGGCATCATTCGTCTGTAGTTCCACCATCGTCACATCCCGCATCGAGTCCCTTGC
CATCACACCATCACCTCCACTTTCACTCACACCATCATCTCCACTTCCAGTCACAGGGTACGTCTTGTTCGAGTCGGGACGAAATACGTACGCACCCGAT
TTCGGACCGTCACCTTGGAACGCCTGATAGTATGCGACGTCAAGAGACAGCGGGATCTGGATGTTCTTCTTCTTGTTGGCAAGTTTCGTGAGAGAACCCG
TGGTCTTGCTGATCTCCGCTCGCATCAGGTTGTTCTCCAGCACAACCACGTCGTCGTTCTCCAAGTCGACATTCACATTGTCAACACCGGCAGACTTCTG
GTCTGCTACGGTATCCTTCTGCTTCACTAGAAACCGAGTCGTGCTCAGTGGCTTCAACTCCACACTGACCACGAACGAGTACGGAGCCACCTTCGTCTCA
GGGTGTACCGGAAGAGCTACGAACACGTCCTTGCTACGAATGCTACCATCACCCGACAGCACCGATATCTCTGCCGACTTGTGCACAATCGGAATTGACA
CCGTCTGCACACTCGTGCGTGCCAGCGCATTGTGTACCAACACCTCGAAGTCCGTGTTCTGAGTGGATATGTCACACACACTCGTGTTGGCCAGCAGACA
CAAGTGATACGGTTCCTTCTCTCCGATCACAAATAGCACCTCATTCAGCTCCTTCTCAGCCTGGATGATACCATCGTTGATTCGCAGAGCGTAGTCGTCA
GCGACGCTCTGTTTCTCTGTGCCGGAGAGACCGTCATGGTGTTGCACGAGACCCACAGCGCGCTGCAGTGCGACTAGTGCACTGGAGTGATGACTCTGGT
AAACTGCATCGAGTTGGCGAACTTGCTGCAGCAAAGTGTTCGCTACCTGTGCAAACCTCTTCAGTGTCGGTCGACTTGTAAAGAACCCCGACCAATAGTC
ATCACGAGCCGATCCGTATGGGAAGAAGTCATCGGTCTTGACACTCCAAGTCAAACCCTCCGCACGCTTCACGTCTGTATAGTGCGAGAGGTTTGAGTAT
AGCACGTTGATTCGGCCATCTTGATTGACGTAGTGAATAAGCTTGTCCATGTTCTTGAACCAACGGAGTGAATTGTCAAATTGGAAGTCACATCCCATGG
GAATGAAGATGTGGTTTCCCTTGGACGCACCACCACGCATCTTGGCATTGTTGACAAACTGTTCCACTTCATCACAAACATCAAAATCATGCAGCTCCGG
GTCGTCTTGGATCTGGTTGCCATTGTTGCCAAAGTCGAATTTTCCAGGTGGACAGTAGTGATCAATGATCTCACCAGTGAACACTTGTGATGCCTTACCA
CGAGACTTGCTGGGACGCCAGATGAACTCCAGATCCTTGTTCTTCTTGCGGTTTCCATAGTCTTGATAGTCGATACGTGCGAAGTACAACGCATCAAAGC
CCACACCCTGGGACAACAGCGAACCCTGCGTAGCCGAGTGACCGAACGGATCGATCTGCCACCCGATACGTGGACTGATGCCGAACTCATCCATGAGCAG
TTGGTGACCGTACGCCGTCTGGTCCACCATGGCGATGTAGTGTGGCGTGGCCTCGTCGTGCATGCACCAGCCTCCATTGACAGTCAGATCCAACCGACCC
TCACGCACGAGCTGCTTGACGATGCCGCGTACCTCAGAGCCTTGTTGATGCCACCAGCGTTGGAAGAACGACTGCTCCACGAACATGAACTGGCGGTCTG
GGTTGCGCACCAGCTCCTCCACTGCCGTGTCCAGGATGTACTGCACCTTCTCCATGTAGTACTGATCTACACCCATCAACCAGCCTCTACAATTGCAATA
GGTTAAGAGGTTAGTACAAGCAGACTCAAGTCGAATGCAACGGACGTACGGGTCGTCATGGGAGTGCGCAATGAGATGCACATTGAGTTTATTGGGGTCT
ATGCGGCTCGTGGTGTTGTACACGCCGTCGGTGGGCGGCGTCCACTTGCTGGGGTCGCAGGCGGCAT