Description :
From Genome Similarity Track
Location :
Scaffold_93:69539- 71414
Transcript NameFunction/comments
g12418.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
CTTGAAGGTCCACCCAGCGGCCTTGAGCTCCCGCCATACGGTGTGGTAGGTGTATGCGTTAGACGACGCCTTGCTTGTTCGCTTGGGCATCTGGCTCACT
TGTGCGATTGCGGGGGATTTTGAAGAATGAGGGGGAAAAGGAAAAGCGGAAGCTGGGGTGGCGACGGGGAGAAAGTGAGTGGCCACGAACGCGTCTACTG
CGAAAAATAATACACTGGCTTTGCGCAACCACACCTGCTTCTCAGAATGGATATTTTGAATTTCTGGAAATCGGATGCCGCCTGGTTCTACCAAGTGGCC
GTGGTACCTGGACAAAAAATGTGCTGCTGTCTCGTCTAAAATTGTATTGAAGTTTGTATGCCTCGGGGCTCGGCTAATTTTTTTCACATACAAAATTCAA
GTCTATTTCCGTCTTATCCTGCATTATGCAGGATAAGAAATTTGCCAATTCTGCATTATGCAGAGCTTCGGGTTGGAGAGGTTAATAATCCTCGCATCTT
AATTAAGTGATATTAACGATTAACATCGACTGCCAACACTATTGTGGACATAACCCGCAAAACACACAGAAATATGGTTTGCCACACCGATGATGGGAAA
TCACACAAGATGTGCGTGGTACACACCAAGAGCACGTTGCGCCACACTAAAAAAACACGTGGCACACTTCGATATGCGACCACATCAAATAGGGGTGATT
CCACACCACTCAAAATCAGTGAATCGTTTTCGAGATAGTGTCAGCATTTCGACCAATTGAAGCGGAGTAAATAGGCTGCATGTGCCTTCATATCTGTGGT
TGTTGCCAGGAATCTCCCTTTATCCTCGAAAAATCAGCTTACTCCGCGGACCCCACCTCCCCCCACCCCATCGCTCCAACATGCCCCCAACGTACAAGTG
GACAACCGTATGCAGCAAATGGGAGCCCTCGCGAGCCATAGCGAAACTACTTCGAGACGCAGTGAATGACGAGCGAGTTCAGCCGCTGGCAGTGTTTCCA
TACACCAGATGGCTATGCGACGACCAACAACCCGGTAGAACCGTTCAACTGCCTGATCAAGCGTGACTACACACTCCGTACCAAGCACAAAACTGGAACT
CTCATCCGACTGCTTGCGGACTGCTGAGGTCACCAGTCGGTGACACCAAGACCATTTAAGGTAATGCGTCAAGTCACTCAACAGTTGAAAGCTCGTGTAA
AAGACTTTCGTCTGCGTGGTCTGCTCCAAGATATGACTCCAAGCCAATCCAGTATCAAGTTCTTGCTCGTATCCCCGAACCCGAACATGGTGCGCGTGCT
GTTGTGTGGTTGCAATTGTGTGCTTCTCCCTGAGCTGGGCCGGAGCGGCGAGGTCGCTCCTATTTCAGCTCAAATGGGAGGTAACCATGCACGAATGAAG
TTTGAAGGACAACCTGCTGGTGGTTGGCACATGGATGTGGTCAAGCTCATATGTGGTAGCAAGTATTATTTCAAGTTCGCAATTTGCATCCACGTTGTTT
TCGCTTTACAGATAAAGGGTTATACCGGGTTGGACAGAAAGTGACCGCTTGTCAACCATTCTGTTTCAAGGAAGATACGTCAAACCCGTACACACAGCAC
TCGCGTTCCTGCTCGCCGACCTCGTACCAATGGACACGCCCTCAGTACTGAATGAAGTTAGAGAAAACGTGGTATATCCAAAAATACACAGTCGTTGCAC
TTCCCATCCGTTTTCTTAATGTAATTGCTCCAAACGAAAGATGTCGTACTTGCTATGCTGTGCTCTTATTCAAACTTTCATCACTACAGCGACTTCTAAC
GGCGACGTCCAACTCTACTCAAGCACCTCCCACCACGTTCAAAGGGTTTATGACTAGTACAAGCAACACCTAAGC