Description :
From Genome Similarity Track
Location :
contig_130:69535- 72656
Transcript NameFunction/comments
g13605.t1hypothetical protein

Sequence
3121 bases(100 bases per row)
GGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGAC
CGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTC
GTCTCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGT
GCTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGT
CACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTC
TCGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCT
TCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCAC
CTCGCTCGTGGACGGCACCTCCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGAC
CGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTC
GACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGC
TCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGT
CTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGAC
TTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACATCTCGGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCG
TGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTC
GGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTG
GGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGG
ACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGT
GGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGC
TTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACG
GCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGT
CACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTC
TTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCA
CCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCAC
TTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTG
CCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCT
CCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTC
CGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCC
TCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCT
CGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGT
CACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTGGGCTTCTTGCCCTCCG
TCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGT
CGTCTCAGTGGTGGTCACTCC