Description :
From Genome Similarity Track
Location :
scaffold_83:69530- 71644
Transcript NameFunction/comments
Pl_110199conserved hypothetical protein

Sequence
2114 bases(100 bases per row)
GAAAATACTTTTCTTGTTGGTTAGTTATTTTGAGGCCTGCACGAAACCTCACCATCGCTTCGCAAATGTTCATTCTCGATTGAAAGCTCCGGACTGCAGA
TTGCGTTCCTTGCCGAGTCTCATAACAGTAGAGAATCATGCTCCGAAGGTGAGCAATTTTTTTTTTGTGCGAAGGTTCGAGCGATGAACTGATAAACTCA
CAGCCCAGAACGACATACACATCATGCGCATCATGAGGAATCGTGTCCTGATCGAGCTACCAACCAGAGTCAGGAAATTCGTCCGACGTCGCTACCAGCT
CCGCTTTCTGGTGCTGAGGTATGTGAAGTTGCCACAGTCAGAAACAGCGACAATTGTTGACTCGTCATCTATTTATTTAGGCCACTCAAGCTTTGTTGAA
AGCAAAAATCCGTGAAATTCAGTCGAGCCCGGTACTCACGCCGAAGCAAAAAGCTGAGTCCGTGCAAAACCTCATGATGAAGGACTGGAATGATGCCAAA
TCGAAGGCAGGTGCTACAAAAGCGGAGTGTGATATCGAAGTCGAGCGCAAACGAAGATCATACAACGTACGTATTTTTTCCTTACAACAGGAGCTACCGG
TCAGTTCACATTGACAAAACAGGATGAAGCCAAAACGATTTTGGGTTGCAGTCACTACCAGTACGTGATTACTAGTTTTACACAGTTGCGACTAGCCAAC
ATCCTGACTAAATAGTTACTCTCCATTGTTTCAGGCGGAAATGCAAGCTACTTGGCAAATGCTGTGGGAAATGGTATTCATGCCGTTTCTGCCACGGTAA
GCCATGACCTCAATGGATAACTTCAGCACTAAAACAATCAACAAAATCCTAACGAAATGTTGACTTGTCAGATGACAACGAGGACCATGCTTTTGATCGC
TACGCTGTTGACACGGTATCGTGTCTGAAATGCGATACAGTCCAGCCGATCAGTAAAACTTGTGTAAATGAGAGCTGCAAAAGCGAGTTCGGGCGCTACT
TTTGCGAGGTGTGCCGATTCATTGATGATGACCCCATCAAGGACATTTACCATTGTGACAAATGCAAAATCTGCCGCATCGGTAAGGGTCTGGACATCGA
CTACTTCCACTGTGATCGCTGCAATGCTTGCATGAGCATCAGTCTAAAGAAGCACAAGTGCGTAGAGCGGTCTCTCGAATCAGACTGCCCGATCTGCCAC
GCGTACATGTTCACCTCAACGACGCCTGTCATGTTCCTTCCTTGCGGACACTGTATGCATGTGTCTTGCTACGAAGAGTACACACTGGTGCGTAATTGAT
GAATGCACATGAACAAACTGACTAACGAAATTTCATTTTGCTTTCGCAGACAAACTACATCTGCCCGTTATGCTCAAAATCTCTGGGTGATATGGAGCTG
TACTTTGCCAGTATCGACGAGCTTCTTGAGCGCGAGCGTATGCCTTCCGAGTACCAGGACTACAAGTCGCTGATCTACTGTAGCGACTGCGAACGAAAGT
CCACCACCAAGTTCCATTTCGTCTATCATAAGGTGCAGTGAAGCTACCGTCAGATTTGTAAAGATACTGCACACTCACGTGCCTTGTTTTGCTGTGTAGT
GTCAACACGAAGACTGCATGTCGTACAACACCAAGCTGCTGCGGCAGTTTAAAGACTCGGAAGGACAGGTTGCGTGCGGCCCTACCAGCCAGACCTAGCA
CTAGCACAGAGCTGCAGCCTAACAGCTTGGATATTTGCCTAACGCGAGTCAAATAAATCCATCTAGAAGCTACATTTTATTGTTGTCATTGTGGTATGTA
TGACCCAGTTCTTGAGGAGTTTGACGAACGGACAGTCGTCGTCCTCTACACACATAGGGCTATTGGGGTTCACTCTAGCGCCCGTGGGGGTAGCACGACA
TGCCTCGGTTCCTCAATGCAGCGAAGCACTTTTCAGTGCCCCAAGCAGAGAAAAATCTTACACGCGTTCTCTTATAAAGTCCACAGCGCACAACTATTTG
ACACGACAATAAAACACAGTATGTATCATTCTTGACCTCCTGGTCAATTTGAAAAGTGAACATGCCACGTACTTGTCGAGCGTGAACCGGCTCCTCTCCA
CCATTCACTTTCAT