Description :
From Genome Similarity Track
Location :
Scaffold_567:6952- 8233
Sequence
1281 bases(100 bases per row)
TGTAATGGGCCTACTTAAAGCCCACTACTTCGGCTTACACGTTAGCGCACGTGTATGAGGAAGCGTAGGTTGCGTTTCACTAAGATTAGCTATACTTTCG
TCCGAAAGTATATACTTTTTTAGATTTACTTAAATAGGAACCAAATCCGATTTCTGGTAACAATAGGCACTGTTTATTTGTTTGTTTGAGTTATCCTCCT
AATCTAATATTCTAAATAAAAGGTATTTATCAACGAAAGGTTGAAATAATCCTACTATTCTAATTGGTGGAAGATATTGACTTTCAACCAATGAATGTCC
CAAATGCTTGCAGTCTACCAGATGTAACCATTGGTGCATCTCACACCAACGTTGAGAACCTCTTTCGTAACCTAGTGGCTACATGGATCCACTTGCGTGT
AACCCCGTTACCCCCCCCCCCCCCTACCCCGTTAAGCTAAGCCTCTCTAGTCTTAACACATCATTCAAAGAATTGACGAGACCATCAAAACGTTTGAGAA
GCCCGAGCTCATTTCGCAATGAGCTCGCCAAGGAATATGCCCGCGCAAGGGTCTGCTCCAGTAGACTCTGTTACGCTCATGCCTGCACCTGCAGGCACCA
CCACTTCAGTGTCCGCGCAAGCGAACACGCCCGCGACAGAAAGAAACATTTCTGTCGCTCAATACCACACTCTGCATAAGCAGAAGTGCGCACAAGCTAC
GACTGACAGACCGTCACCGCTGTTATGTCGCGGCAGGCCGTGATGATATTCCGGACGCTCCTGCGTCGAAGCGACCGCGCAATGAAAAAGAGGCGCAGCC
ACCTGTGTCGGTGGCGCCTTCTTCTCCGCGTACTGCACCTGCAGCACGCGCTCCCTGGATACTAACTGCAACTGAAATAGCTGAAAGGTTCGGCGCGACT
TCACCGCCGAACCCGATAGGACTGTACGTGTGCATCGTCATCAATGATGACGCTGAGACCGTCGACATGCACTTTGCTTCGTCAACATACCAAAGGCACG
ACTACTACATCGGGCTCTTCCATGAGCTCCGATGGAATGCGTCGAAGAAGACTTCGCGCAAAAGCAAAGTGGCCGAGTGGGTGGCACTTTGTCAATCTTG
GAACGCATTTGCTGTGAACTTTAACAACAATGCGAAAGGCTACCGCGAGCATAGTGTCGCGGCTCGCCAGCGCTTCGAGTCCTTCTCGAGACGTCATCTC
ATCGATCGCCTCCATAATGACGCTACGGAGGCGGGAATTCCCTGCGCAGCTCCACCTGAAACTGCGTGTTCGTACTACCGC