Description :
From Genome Similarity Track
Location :
Scaffold_97:69502- 77373
Transcript NameFunction/comments
Phyke_g4243kinesin-like protein
Phyke_g4244DEAD/DEAH box RNA helicase putative
Phyke_g4245hypothetical protein PHYSODRAFT_560612

Sequence
7871 bases(100 bases per row)
GATAAACTTACAAGACGAGGATATTATAGCTAACGGACGTTGGTGGAGGACTCACTTAACGGCGACTTGGCGCGATACCGCTTTGGGGCGGCTAGAGCCG
ACATCTTCGTCGACTTGCGACCTCCAGCACTCGGCACCTTCAGGCTCCTGTGCGGATGTGCAATCGCAGGCTTCTTGTTCGTTACAGTCGACCCCGTTTT
CTTGATCTTCGATGCAGCACTGACGCCAGGAGTCGTCGTTGCCACTAAGGCTGCCGCAGTGGCAACAACGGCAGGAGTCTTAGTCTTGGATTCAATTGTA
GTTGCACTCGACCCGAGAGCTGACGCTGGGTTCGTGCCAGGAGACTCCAGACTGGAAACATTGGCGATGCTGGTCTCAGCGGGGATACGCTGGGTTTGCA
CGGGCATGTCTTCAACTGCAGGTGCATCACCACCGATTGGGCTTGAACTCACATCGCTTAACCTCCTTCGCTTGCGGTTAGCGACAATCAACGAGTCCAT
GATGCTTGATGTGTTCTGGATGAGAGTTttgtcatcatcagcaacttTGGTGGCTTGAAACGAGGGGAATCGCCGATTGTCCTTTTTCATTGGTGTTTCA
CCCGTGCGTTCATTTACCTGAGCAAATAGCCACAAAAACGTtgacatcagcaacaacattACTAACATCTCCTAGAAAAAATAGCGCACAACTTACCCTT
CGCTTCTTCATGTACGTCTCCATGTCTTCCAGGTGCTGGGTAGAGTCCTCAGTGGCATCACCAACAAGCTTCCTGCCAAGATCAGACGCGGGTTTAATTT
TGTCATTTGTACTGGAGAGGTGAGTTTGAAGTCCGTCCTCCAGAGTTTTGCATCCACCGCTTAGTAGCTGTCGAAGGTCTTCGTGGTCACCGAGGAATTG
CGATATCTGCTCTTGTCTCTTGCTCGATATATCAACGTCGGCTTGAGAATGGTGTTCCATCAACCGTGCCACCTCTTCCTTGTGCTTTTTCACAAAAGCA
ACAGTATCTTTACTCCAAACGGTTTGTAGCCTCTCGTGAGACTGAACCAACTCCGTCTGCTGAGCATTCGTCTCATCAAGTTTCCCTCGCATATCTGAAA
AACGCTCACGAAGTCCAGCAGTCTCGTTTTCTTGCTTTGAGTTCTGCTGACCCATGGCCTGAACGAAACCGTTCATTTCTTGCTCTGTCATGGTCTGCAC
GTACGTAAGAtccttttgctgctgcttcgcgtTCTCTTCGATGAGCAATGTCTGCTCACCAAGTTTCTGTGTTTGGCCCTGGATGCACTTGTCCACGTAT
TCAGCAAGCTTGGCCTTCACGCCGTTCAattcctcttcttgctgcgcatGACTATTTTTTAACGTTGCCATCAGCGCTGCTTTGTTTTCATCGAGAAGTT
TGGTCTGCTTCTCGATGGAAATATCGATAGCGACTTGAAGTTCCAAAAGCTTGTCGCTCTGCTCAGACAGAAAGTTGCCTAGCTCTTCTCGGGATCCCTC
TAGGGTCGACTGCACGttctccaagaaggacaTGCTTCGGTTTTTCGATGTGGCCAGGTCATCGGCAATAGCTGCCGCGTGGCTTTTGCTCATCTCGACG
AACCTCTCGAGCTGTGCTTGCATTGCTTCTTTCTGTCCATCCATTGACTTCGTCATATCTTCACGCTGTTCGCGCTTTTGGGATTCATCTTCGGCAAGAG
CTTCGGTAGTCTGTGCTCTCCGTGCTTCGACAAGAACCTGCAACGCGTTTAAACTCGTGGTCAGACCGTTCAGGTCTGTCGAATGAACTGTTTGGAGTTC
ATGCAGAGCATTGGAAACATCCTTAAATACACACTCTTGACTTTCTTTGTGCTTTGTCAATCGCTCTAGGAACGAATTGATCCGGGACTGTGATTGACCG
CGATACGATGTCGCCAATTCTGAATTGGCTACCTCTACTCGTTGTGATTTCTCTGTAAACAAGAAGGGGCAAGAGTTAGTTAAACGAAGTGATGTCGTCG
CGAATACGGAATCAGGGAAATACACACCAATCTTTACCAACAGCTGCGTTACGCTCGTTTCGCTGGCATTGTATAACTTGGTAGCAGTAGCCCCGTTGGT
GATAAGTACCTGCTCGTTGTCCTGAAAGGATTCCAGCACTGCCTGCGTCCTATCCAGCTTGtgcatcgtcttctccagtgctTCCTCAGTGAAAGCAAGT
TTGCTTTCTGCGGAGGCCAACTTGTTGCTTACTTCCTGTTTTTCTAGCGTCAAAGCCGCCATTTCGCTGGCATGTTTCTCAGCAACTTCCTCGAGTTCTT
TGCATGAAGCATTTCTCGCTTTCAACATATCTTCCAGCTCAGTTACCTGCACCCCCTGCCCAGCCAGGCGTTCTTGCATATCCGTGAACTGTTCTAACGG
CAAGTACACGCCGTCTTTTAAACGAGCAGCGCGTAAAGCTGCACGGAGCGTCTCAATCTCATTGCCAAAGTCGTTTAGCAGTCCTGCCTTGGTCATTTTC
TGGTTTAACTCTGGCTTGTTTTTAATACTTTTCGCTCGGAACGCGTACTCCAGTGTGCTGAGGGTCTCGTCAAGACTGTCGGAGCATGGAGCCAAGGTTG
CAATAATCGTGGTCTTCGCACGTCCACCAAGCGACTCTTGCAGCAAGCGGGTAAGCTTGCTGTCACGGTATGGAACGTGCGGTAGGTTGTCAACAAGCGC
CGTGATCACTCGTCCGAGCGTCAACAAACTCTGGTTGATCGTCCCTGCCTCCCGCGCTCTGACGTTGCGTGCCCCTGAACGTCCAACGCACTCGGATCCA
GCAAGATCCACTAGATTCAGCTGTCCAACACGTAGTAgatcttcaccagcagcgttgtGCTCTTTGCTGTGTATACGAATAGTGAAAATACTGTGTGATC
TGCTCGAGTTCTCGTTCATTAGCGTCTCGGATGTGATCCGGTTCTTCACGCCAGTGTTCACCAGCTCAAAGACATGTTTGGCCGTCGTGGCCGTCACTTC
CAGGAGGTTCAAACAGTAAATCCCTCCTCTCTTGGTGTCTTCCATCAGTCTTAGCTTCTTGTCTCCATCGGGATCCAGCAGGTCCTTGAGTTCTTCATTg
tagagctgcaggaagGAAACCCTTACACTAAACTCCTCTCCTTTGGCTTCCAGAGCCTCAAAGATACGGCGGACACTGCGTGGGATAATACCTGCAGTCT
CACTGCCTGGCTTTAAGTCCCCCTGCATCGTGTACGTCTTGCCTGTCCCTGTCTGGCCATAAGCAAACACAGTGCAGTTGTAACCAGccagcgcttcatc
cactGCAGGCTTCACGACGGAGCTAAACACATCTTTCTGCGTCGAATACTGGCCAAATACTCGGTCGAAGGTGTACGTCTTCCGCTTGACTACCGCCACC
TCATTGGAGTTCTGTTTACACTGCACAACAGCCCCACGACCAGTTGCTTTCTCACGGGAGTTTAAAGGACGGCAACGCACCGCCACTTGGACGTTCGTGG
GCATAGGAATGGGCGCAGCGTCCTGTCCActagaagaagaggaagatgacaTCCTTCGTGTGTCGACGACGTCTGTCATGCGCTGTATAAAGGCCGTAGA
TGGATGCCCTCTCTGTACACTCCGCTCTTGGAACGATGACCGTTTTCCCGCCGTGATTTAAATTCAAAAATGGGTAAAACAAATAAACAAATGGGAAAAG
GATATTAGTGCAAATCGGTATACTGGTACAATATATCTCACTATGAACTTAACCGGTTTGAATACCGGTATTCGCTGCTGGTGTCCAACCGATGTTTGCA
TCAGTCTGAAGTTGAGCACTAGAGCTCCAGACTTGCCGTCGTTGTAATCGTTTGTCATGGCGTCAGCTCCGCCCACTGTAAGCGACAATCTGTTAGACGG
ACAGAAGACCTTTGCCTCATGTGAGTTTGGACTGGACCGTCGTCTCACAAAGGCCGTGGCCAAGATGCGCTTTGTACATGCCACTCTGGTGCAAGTGCAC
TGCATTCCGTTGGCACTACAGGGCAAGGACCTGCTGGTTCGTGCCCGTACTGGCTCCGGCAAGACTGCGGCCTTCTCGCTGCCGCTTTTGCACAAGATCC
TGCAACAGAAGCAGGACGCAGCAGCCAGTGAACCTGCTATTCGTGCTCTGGTTTTGGTGCCCAccaaggagctggtggagcagacACGTCGTCacatgct
ggagctcatgTATTACTGCCAAGACACAGTGAGTCTGTTGGCTCTGGGTGGACAAAGCATGAACGCACAGCAGGCGTTGCTGCGTGACGCGCCGGACGTG
CTGGTGGCCACTCCTGGCCGCCTTGTGGCTCATCTAGAAGCTGGCAACTTGACGCTCAAGGACTCGGTGCAGACTGTAGTGATTGATGAAGCAGACTTGG
TGCTGTCTTTTGGATATGGAGAGGACGTGCGCACCATTTTCAATGCGCTGCCCAAGGCTTGTCAGACGTTCTGCATGTCGGCGACGTTGAGTccggagct
ggagaagctcaagaagtcGGTGCTGCACAACCCCgcggtggtgaagcttgAGGAAGGAGCGACTGATGGtaagctgcagcagttctaCTTGCCTGTGAAG
GAGAGTGATAAGGACCTGTTGCTGTATGCTTTGCTGCGACTTGGTGTCGTGCATGGTAAGGTGATTTTCTTTGTGAACTCGACAGATGCGGCGTACCGGC
TGAAACTGTTCTTCGAGCAGTTTGTGATCAAGAGCGCAGTGCTGAATGCGAAATTGCCGCACAACTCTCGTCAGCACATTATTGAAGAGTTTAACCGCGG
ACTTTTTGACTACCTCATCGCGACAGATGACAGTGTTGACCGTGAtgttgaggaggaggaggaagaagatgaggaggaggatgaagatgaggaggaagag
gatggagatgacgctgaagacacggatgaagagaagaacTCAGCTTCTGATGTGGAAGCTGATGATGCGGAGGAGGACAAGGACGCAGAGGACGGgggtg
atgacgaagaggacgatgagtccagcgatgatgaaaatgcacaggaggaggacgctgaagaagatgatgcccaaccggagaagaagacggtAGGCTCGAA
GCGAGGCCGTGCCGATGACGAAAGCTATGGTGTGTCACGTGGTGTTGATTTCCGTGGTGTTCAGTTTGTTATCAATGTGGACTTTCCGAAGAGCGTGCGT
GCGTACACGCACCGCATTGGTCGTACTGCTCGTGGTGGCGCCTCTGGTACGGCGCTATCCCTCGTGTCCAAAGATGACGCCAAGCAGGAACGTGCCCTGA
AGCGTGTTCAGGCGCGTCAACAGGCTGCACTCTCCGAGTCGAACGATGTGCTTGCGCAGCCTGCGGAGCTTGCCTTTGACCTGAAGGAAATCGATTGCTT
CCGATACCGTGTGGAAGATGTCCGACGTGCAGTCACACGAGTGGCCGTACGCGAGGCTCAGCTCGCtgatgtcaagaaggagatgtTGAACTCTGAACGC
CTGGCGTCGCACTTTGAAGCGAATCCACGCGACCTCAACATGCTTGAGCACGACAAGGTAGTGGGTTCTGCACACGTGCAGCCTCACTTGGCCACAATCC
CGGATTACCTTGTGCCCATCGAGTTGCAGCCACCGGCACCGTTACGCACTAAGAAGAAACACAACAAGCGGCAACGTCTTGCCAACGGCAAGCGCCGTAC
GGACAACGACCCACTGCACACGTTTATGGTTGCTGACGAAAGCACCAAGGTagacaagaagcaacaggaagagGACCGCATCAGCTACGGTAACTCTGGC
GTGGGTAAGGGCACTGCTGGACGTCagaagtggaagaagcagcaccgTAAGGGTAACTTCAACCCCAAAACtatcgccaagaagaagttcaagatgAGCA
TGGGCGCAACTCATTAAGGAGCTTGGAACTTCGTGCCGTGTTTATGTCTGTGCCTAGGCTGGAGCCTTGGCGCCAGATAACATGGGCTTTGTTCTTTGCT
TGCCAAATAGATACACGCTTTGTTTTCCTCGTTTGTGTGGTTTTGTATCGTGCTTGTTCAGAGATTGCGGTCCACAGCGGAGGAAAAGGCTGGTAGCGAC
ACAGGCTGGCTTACGCCAAAGTAGCGTAGTGCCGCTGGTGGCGAGTTACTTGGAGGCATGAAAAGCGCGAGGCTGTCGGGGCATccctgctcctgttgct
ggatGAGTTGGCGCCAGAGCTCGTCGCCTGCGAGCTGCACGATTCGGTCTGCTGGGAGTTCCTCGTCGGCCACATCCACCTCCACAAGCGCCGAATTTGC
ACGGGGCTGATTTGCTTCGTCCAACATCCGCTTGCGGTCGTATACGTagtccagcagctgcagacttCTCATGTGTTCTGCGTGCTCGCGTTCCACACGT
GCAAGACGCTTGCGGTCTTCTTGAGTTTTggttgctgctcgtgcagctaGGATCTCAGGCGGAGCTGGGATGATTGTGCtcgtggaggaagacatCGTGA
AGAGGGGTTTGTTTCGACGCACCGCTTCTTCACGGAGAGCTCGGAAGTTGCGTGCAAAacgcagctcttcttcggctAGAGTCTTCATGGAACGTACGTC
TCGTGTCCGCTGCTCGCGTGCGTCCTGCTCAATTGCTTTGCAATGCGCTTCGTGCAGTTGACTCCATTGGCGGGTTTCGTCAACACGAGCAATTTGCTTG
TCAAGCTCGTTCGTGTGGTGATCACGCATTTCTTCGTTGTGCACGTGACGCGAGATCATGGCCACACTCGAGGAGAAAGCACGAGCCATCTCCATATTTT
GCTTCCGTGCTCTCCGAGCTGAGGCATCcgcttccttcttcttccgacgctgctccagcttgtCAGTTTTGAGCTTGGTCAGTGTCGCAAGTGTGAATGG
GTCTGGTTGGTTGTGTGCGCAATACTTGGCGTGTAGCAGTGCTGGGGCTGATGCAGATGCTGCCAATGTGGAAACTCGAGGCGGCGGATGTCGAGCGTAC
TCCTCGTAGGAAAACGCGCCGGCAGCGCTACTTTCACGCGCTAGCTCGTCGAAAGGCACCTGGATTGCTCGTGCAgatggctgctgtggctcGTACTGCA
GTGGGAGCagctttttgtgctttaACTTCATCGcgtcttgttgctgttgcagatTTCGCGCGTGTTCAATGAGGAATGCCTCGGTAAACCAAAGTTGACA
TCCCTGGATGAATTCACTGACGGAGACCATTGGCCccgctgttgttgttggatCAGCAGTCGATAATCGCTGCTCCCACCTACGAAAGCTCGAATCGTCC
ACATCCAGTCCATGAAAGCGTAGGAGCGGCTTGATCTGTACAAGTTTCAGACGTCGGGTGTGTTGCACGTGTGCATCGAATGTCACCATCAGTTTCTCGC
AGGCAGCCATGAACGTCAAGCGTCGTTGACTAGGAGTTTCCAGTGTGTGTGTTAACCCGCTATCAGGTGATAATGGCATTGCGGACTGTGGAGTTACTGA
TGCTATTGATCCTGACTTTGAAAGTGCAGGGCTTTCGTACACAAGGGGTCGGCGATCGAGCTGCCTGGCAAACGGTTGGGGACGTTGCAGCATGCGCTTC
ACTAACTCTCGGTTGCGTACAATGGTTCCTAGTGTCTTGATAGCGGCAGTCGATTGTGGTTGAACGAGTGGCACAGCCTGACGATAGAGTTCAAGCATCG
TgtcatcaccttctccagGTCCAATTCTGATGCTCTCGAGACTGCTGTAGTTGTCGGCTGGATCGAActcatcgtcttcattttcatcagAGAGAATTTG
AGGCTGTTGAAAAGGAAGGAGGTACTCTACCAACGAAGATACTGGTCGACGCATGACACAGGACACTTTGT