Description :
From Genome Similarity Track
Location :
Scaffold_172:69501- 72463
Sequence
2962 bases(100 bases per row)
AGAAAGTCGCTCGTGGACGTTAATTGAAATGTCAGGACTGCACCTTTGTCCTCATCAACAGCAAAAGTACCTAGATTTCCTACCAAGCATGTGTTCCCGA
TGCAGTTTTCGGGAACGCGAAAAACAGCACTTGTTAGAACTGGAGCATCATTTGAGTCTGTCACAGCGATGCGATAATCACACACTGTTTGAAGCCCCGT
TTTATCCGTAAAACGAACGGTGAAGGGCACGGTGTCCTGGACTTCGTAGTTGAGATGTTTTTTCAACGTCACTTTACCAGTGGAAGAATCCACATCAACT
GTTCCTATCGGGATTTGAGATAATACTTCACATATCAGATGGTCGCCGGAATCGGGGTCGAATGCGTACCCACTCAACTGTGCAACTCCAGTCTCAATCG
AGGTATTTTCAGCCACATTAAATGAAAAGGATACACAACTTGGTGGCTCTGGCATATCTTGGATCACGATAACCACGTTAGCGTGAGATTCCAAGCCACC
ACCGTCCTTTGCAACAACATCCAATACGAATTCCGTTGTACTTTCATAGTCAATAGCGTTGATCGCAACGATATTACCATCCCGAGTAATGACAAAGTTG
CCATTCCCACCACTAGATATAGATAAGGTATGCGTGTCGTATGCATCTGGATCAATGACACCAACAGCAGGCATGAGAGTTGCGGGAGGTAGAGTATTTT
CCTTCAATGCTCGAGAAAATTGGTAGCCGCTAATGATGGGTGCCTCATTGACGTCTACCACATTCACATGGATTTTACACGCCGCAAACGGTGCACTCGC
TGAGGTCTCTTGGATCATGAGTGTTATTTCGTATGCGTTTTGATTCTCGTAGTCTAATGCCTTCATCAGGATTAAATGTTTCTGCTCGTTCAGTTTGAAA
AGGTTTGTAGAAGTGGTCCATGTCTGGAGGTTATACGTCATACCGATTGAAGAAGATGCGAGGCTAAAACTGACATCCGAGACAAATCCAGGGTCATTTT
CGTGGATGCTCAGAATGTGATTTCTGTCGACACAAATCGAATCTGGGAACACAAACGACAGCTTACGAGCACCACCTGAGCAACTATAGCCCGTGGGACA
CCTTTTGTATTCGAATCGGCGATCATTCACAGAACCCTCCGGAATAGAATAGTAACCCGCTGGGACATTGATAGCATTGTAATACGAGATTGCTTGTGAT
AGCGGGAGTGCCATCTGCAAGTTGTAACGTGATCCTGGGGTGACCACCTCGAACGTCGCTGGAGTAGTACTGTCATTGACGCCAACGAACAAAAAGCCCG
AGGCTGTAGAGTTAGTACTAATCTGAGATATGCCGTACCCGGTTATCCAGGTACTCAAACTCGACGGAATTTTCACGATACTTGTACCAACGAGAACAGC
AATATCCCCAGCACCCATCGCAGATAACGTGGGCATATAATTATTAGACATCGTAGCGTCAACAGTAGTATCAAACATCTTCGTGCCAAGTGCCGAGTAC
ACTAAAATATGTAAGATATTTGCTGTATCTGCTATAGTTTTCACCGTTTCTCCGTTGACATAGACACTACCCGTGCAAGTTGGGGCGGCAATTCCGCATA
CCGCGATATCGATATCTAATGAGATAGACTGGCCGTCGAAACGATCGCAGCGCAAGTTACGAAAGCTTGCATCGGTAGATTTTCGGAATAAAATTGTTCT
TTTGGCTGCAAACTGTGATTCAGCTGCGATAATGGACAAATAGTGTTGGGCCCCGGACGATGACACAAACGCAAATGTGAATGTACCATTTCGTGAGCGA
GGAACCGCGATAATCCCATCTAGCAATACAACAGCACCCCAATCAAATCCAGCAACGGGCAGTTGGAACTCGTAGGTGATATCCGTCTGTGAATGTTCGA
AATAAGAAAGCGATATGTTGTGTGCAAACCCAGAAGACCACCCTGTCTTAAACGCAGTCAGGTTTACATCTTTGAACTCGAAAACGTCTATAGAAACAGC
CGCAGAACTACTTGTAGCAGCAAAAACACCTTGCGTAAGGGCGTCGTCCGTTGAACCTGGTTGTTTCGATAAAGGTGCGAGAAGATATGAGATTGATGAC
GAAGTCAAAACTACTTGGTCAGCGCCACTGGGAGAATCTGGGCATCGGCTTACGCTTCCAGCCTTACAAACACAACCTTGCGCACATCGACCAGAGCAAA
GTGAGTTGATGAGACCTACTTGATCGCCGAATCGAGTAGGTGGACACTGATATGCTGTGCCTCGTCGGCAATAATACCCTCTTGGACAGGACAGTATTCC
AGATTGTTGCTCATTCACCATCGATCCGACAGAGTAATAACCAGGTGGCACAATGATAGGGCCAGTGTTTCCTTCTGGGCAGTACACATTTCTAGAGGGG
CAAGGCGCTAACGCAGTGTAGGCACAAGGGGCCCCGCTGGAGGGGCAGTAGAAACCAGCGGGGATTGCGCTACAATTTTGTTGACCTGGCTTCGAAAAAG
TTCCATTCGTGCAAGGAACGAAATCTCTTCGAGCCATCTGATCAAATGGACCCGCATAACCCTCTGGGACATTCAAACATTCGCTTGATCCAGCGTCAGC
AAAGGTGCCAACAGAACACTTAGCTGGTGTTGTTGAACCGCTTAAGCATTTGAAACCTGATGGGCACGATATGCACGCTGCAACACCTGACAACCCAACC
GACGGCCCATACGTCCCGGCAGGGCACATCGTACATCCGTTCGAGTGTGATTCTGAATAGGTACCCGCCGGACACTGTGAACAGTCGCCACTCTGTGAAC
TCGTGTAGCCTGGTGGGCATCTGTCCGGCCGTAAAAGTAATTTTGAGGAGTCATAACCATCCACGTTATCCCATACTATACTCCCCGTTTTCTGACACCA
GCTTTGCGCCCATGCAGCGTAGGATGTGCAAATGGGTAGCATGTCAAATGGCGCGTTTAAAT