Description :
From Genome Similarity Track
Location :
Scaffold_84:695- 5150
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18359hypothetical protein

Sequence
4455 bases(100 bases per row)
GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTGCATTTTTACGTGTTTGTACGAT
GTGTTGCCTCCTCTGTTTTTCATGTGTGGTGTGCTTGCTTGCGTTGAGGTTAACATTGCTGTTCCGCAAGGAGGTTATGCTTCGTGTTCGACACAGTACT
TAAGGTGCGTTTAGTGTGCTCTGTAATGAGGTTAACTTTACTATTCCACATGGAGGTTAAGCTTATTGTTCAATACGGTCCTACCAATTCATACGATAAC
TACGGTTGATTAACTTGTAATACACGCTGTATTAACCCTTTTATCCATGCCTATCCTTATGCTTCAGTCTCGTTGAGCGTGTCGTCTTCCACAGCTTCGT
CTTCGAAGAACTTCTTGCGCACAAGAAGGCGGCGCTCCGTTTCGAAAGCAGCAACAACAGAGGCATGGAGGTGATGACGCGGCTCCCGCGTTGGCTCCCA
ATTAACAAGGTAGAACGTCTCTCGGTTCTGGCGCTTCCAATTTAGCAACTTGCGGACGTAGTGCTTCTGCTCGCCCTCTGTAGCTGCGTCTTCGGGCTCA
GCAGGAGGTGGCTCGACCAGCCACTCGCGTACGTCCTTCAGGCACGTGCGGCGAGAATTCCTCTCGGTCAGTGAATCGCAAATGACGTCGATGGCTTCAG
GCAGCAGGGCGGCGGAGGCTACAGTCGTGTTCATGGTAAGTCGCAGAGGGCGGATTGCCTCATCGCTAATTCGAAGCTTGTATTTTTTTTTGATGTAGCA
ATGCAGCACGACTTGAACTCCTTGTAAGAGCTGACGGTGTTCTTGGTGGACTTGATCGATGGCATGAAGACGGAGTTCTGTGTGTTTGGGTGCGGATTTC
AAACTGAGCGGCAGCACACGTGGGCGCTCGATTGCAGAAGCATTGACTGGACCACATGAATAGGTAACATTGTTTTTATTTACTTACTGAAAACTAGCTC
AAATACGTTTGTCGTATGTGGAGGGGCTGGATCAAGAATGTGACCTGAAGCTTGGAGTTGCTGATAGCGGAGAATGTACTGGTTTAGACTGCCATCTTTG
TGAAGTTTGTGCAAGGACTTCAGGATATTCTGCGCGCCACGGGCTGCGATGTAGTGCTGTTTCAGGAACGTCAACAGCGCGGTTTCGGCACTCTCACCAA
TCGTCAGAACATCGTCACGATATTGCGGGGAACTCTCAACAAGTTTGAAGCCGCCTTCGAGCAGCAAAAGAATTGGTCAAATATGTAGCCAATAGAAAAG
CTTCAGAAATATTACTTCATAAGAATACTTAAGAAACCCTATTTCTTTTTTCTGTCGATCGCGCATGCTTAGTCCCTGGGTCAGTTGAACTCCACATCCG
CGGTTCTTGAGTGTACCAAGTGAACCAAGCGTCTTTCAAATTTGAAGCCGGAGAGGTACGTCGTCGCTTGCGTGGTTGATAGCTATTTTTACATGCTGCG
GTGCTGGTGTCGGTGGATGTTTGTTGCAGATCTTGGCTTCCATCCCAGACAACCG