Description :
From Genome Similarity Track
Location :
Scaffold_765:695- 2393
Sequence
1698 bases(100 bases per row)
AGACTTCGCAGTAAGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGAGGACCTCGTTGCAATGATGCA
AGACATTGCCGCCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGACCCACCATACAGCGTCTTCAAGCGCGT
CCACGCGCCCCACGCTTCCTCGCAGTCATCAACCACGTGATGGTAGTCCGCGTTCATGTGAAGCAACATCAGTCCGAACGCAATGTTGCTCGCCTTGATG
TAGTCGTCCTTGGTCCGGATGTCCGTGAAGCTCGGCGTCGTTTCCCGGCTCACTACGTGCCATACCGACTTGGTCAGAAAAACGCCACGCATGTAGCGGT
TCCACGTCGCGTTGTTGTCACCGTTGAACTTGTCGATGGCGACCTCGGTTGAGGCCGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCATACCAGTAAAA
CCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGAGCAGGATGATTGGACGAGTCC
AGAGTGTTGGTGTCTGGATGCACCACATGATTGGATGCAGACTAGGACGTAAGACAGCGTAAGCTCCAATAAATCAATCACTTTGCATTTTATCATTTAG
TGCACAAACGACCTATCTTTTTGGTTATGAGCCCAAGCCCCGCAGACTCTGCCCAAGACTACGCCTACGCCATGGACGCCACTTCAACGACCGCCCGCAT
CAACAAGTTCGACGGAACCAACTTTCACACGTGGAAGTTCAAGATGCAGATGGTGCTGGAAGAGCGCGACCTGTGGAAAGTCGTCAGTGGCGAACTGAAG
ATGGAGCACTGCGCTACCTCGTTGGACCAAGCGACGTTCAAGCGGAAGTCGTGCAAGGCGCTGGCGATCATCTGTCTCGCAATGGAGGATTCGCAGCTGC
CGTTGGTTCGGTCGGCGAATGGTGCGCATGATGCCTGGTCAAGGCTGGAAGGACACTTCGAGAAGAAGAGTTTGGCGAACAAGCTCTTCCATCGTCGACG
TTTCTTCACCACGATGATGGAAGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCTTCCTTCGTCGACGTTTCTTCACCACGATGATGGAAGAAGGT
GATGATGTGCTGGAGCACATCAACAAGATCAAGACGCTGGCGGAGCAGCTCGACGCAGTGGGCGCTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTC
TGGCAAGTCTAAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAGTCGAGAGCTGACTCACTGTCGTGGGAACTCGTGACGGCTCGGCTGCTGCATGA
GGACATGAAGCGCAAAGAGCAAGGTGGCGGTGCGGACGGCGCCGCGCACGGTCAAGCGTTCATGACGAGTGACAACGGGAAGCGTAAGGGACGACAGGCG
CCAAAGACAAGCGCGTGTCACTACTGCGGCGAACAAGGACATTGGATCGCCAAGTTTTCCGGTGAGGATTTCGTGAAAATGCGGGAGCGACAGAGGGCGC
AACGAGCATACGTCGCGCGCGATGAAGAAGAATCGGGCGAGTTTCTCTTCTTGGTTGGTGGTGGGAGCAAGACCACCAAGTCAAGTGACAAGTGGCTG