Description :
From Genome Similarity Track
Location :
Scaffold_2004:695- 1925
Sequence
1230 bases(100 bases per row)
GCACTACGAACAGATGTTGTCGGCATTTAGATATCAGACAACGTAATTGCGAATCTGCTACGCTAGGCGCATTGCCGCTCCCGACAACACATGGACACGT
CCTTCCTGCGAATCGGACACCAGCGTCTGACAAGCTCTAGGCGAAAAGAAGCCAAATACAGGAGATATCGTACAGGCAATAAAAACTACGCAGAGTGGAG
GCAAACCGTTGAGTGCTAATACAGTACACCAAAATTCCGGGAAAATACATGTTTGGAGGACCCAAGAACATTGACATCAGGACGCACCGACGTATAACGC
TCAAAGTTGTGAGGGCCTGGAGGCGCCAAAACGATTCGNNNNNNNNNNCTATGGAACCTCTCCTTGAACTGTGACAACAAGATCACGAGAACCGTGTCAC
TCCCGATCAGAGCTGAAGCCCTAGTTAAGACTCATAGATCCTGATTGGCCCCAGCTTAGTCTCGCTTCCCAAGGCATCGCGGGCGAACTTGAGTAATCGG
CGCAGCCAGATGCATTCACGAACCGCTGCATGGAGAGTAATCGGCTCTGACTGGTTGGTCGACATTGCAGATAGTGTCTGCTTTGTCGACTTCCATGAAA
TCGCGGCGTGCGAAGACATGAACGCGTAGTCAGTTTGCTTGTGCGGATCTGATAAGTAGCCGGCATCTGCGTACCCGCAGATGTCGTCAGTGACCATGTC
ACCGACCGGTACTTTCGTATCTCTACAATAAAGTAAACCATATTCACGAGTTCTCGCCAGATTTCTCACGACCTGGGTTGCTCATGATCAATGCCTCTTC
CTCGGCCCCGAAGTCTAGCGTTCAAGGACGCTAACTGCAAAATCAATATCTGGGCGTGATCAGTTCGTTAAGTACAGTAGAGCACCGATGGCCTCCTTAA
AAGGAAATTTCGATTCGAGAACTCTGTCACTGCCGCGTATACATCACTTTCTGGTCTCAGGCTACGCACAACCATTGGGGTCTTTGCGGTCTTACACGCA
TCACCCATGTTGAAGCGCTTCAGCACTTTGCTGATATACGTTGCTTAGTGCAACACGATTCCCGTCAAGACTTGGCTCACCTGCAGACCCAGACAGAATG
ACAAGATGCCAAGGTCTTTCACTCTGAATTCGGCCTTGAATGCTGTTATCGCAGCTTCAATTGCCACGTCAGTTCCAACCATGACGATNNNNNNNNNNAT
CTACACAGATCCCGGTGATGGCGATCTTCG