Description :
From Genome Similarity Track
Location :
Scaffold_110:69494- 77540
Sequence
8046 bases(100 bases per row)
ATTGCCCTGGTTTGCATTGTCTTCGACAATGAGCGTGTACTCAATGACAGATATATCTTGTCTGAAATATTCAGGGCTTTCTTTTTGAAGTCTTCGTAGC
AGTCATACAACTCGCTACGGTTCTTAATTGCGTAAGTGAACATGAATCGAGAAAAGTCAGCGATGAAGATCAAGAAGTAACGACAACCAGTAAGCTAGGC
ACAGGTAGTGGATCATAGATATCTTAATGGAGTTTTGACAAAGGTGATGTAGCACGTTGTACAGCTCTATTAGAGTAGAATGAGGAGCGGTGTGACTTCG
CTAACGTGCAGGCAACACAAAAGAAATCTGTCTTTGGACCTAGAGGTATAGATCTATCGAGTCCATGTATGGCTTGGCTCCTAGATAGGTCATTCAAGAC
ACGAACGCTAGGGTGTCCAAGGCGTTTATGGAAGAGCAGAAAGTAACGTTGCTTACCTGAGGCAATAAAAGCCGCTGGAGATGCCGCTGGTTTGGCTTGG
AGCTGATACAGATCCGTGTTGGTAGCCATAAGCGCTTTGATCTTGAAGCGCTGGTCAGTTTGCATATGGCACTGTTTGCGGTCAAAGTTGAAAAAGCAAA
AGTCGTCGTGCTTCACAGACGCTGGAATTGATAGCAGCCTGAATTGGAGCTGGGGAGCATACAGAACGCCATGAAGAATAAGCTTCTGCATAGTGCCCTT
GGAGTCAGTGACTTCCAGAACGACCCGTTCAATGCTTCGATGGGGATTTAGTTATTACCACCAACCGTAGTTGAGCCACCACTGGACGTGATGTCGGTGA
GCCACTGCGATTCATGGGTGACGTGGCGAGTGCAGCCAGAGTCGATTGTCCAGGTGGGGTCGGGTTCTACCTTGGCTTGAGCGGTGAGGCTAAATGGGAG
ATTGACTGTGGTAGCAACAGCGATGAGACCGGTGTCACGACGTCCTTGGCGAGCTACATTGCGGCTGTTCCAGAATCACTGTCGTTGTCTTCTTTCTCGT
CATTGTCTGACTCAAGATAGCGGTCCTTGTCGCGATCTTGGCCGCGTTGTTTGTCGCCATTTCCATGCTTGTCCTCGCCACTACCGCTGTCGCCCTTGAA
TTCGCGGTTGTTGTTATTCTTGCCATGTCGTCCATTGCCACCTTCGCTCGAGTCCTGGTACGGGTGATCGCGTTTCGAGTTACCCTTGAAGACGAAGTGA
GCAGGATGCACTATCTCAGCCTTTACTCGTCCATCTCGCCGATCTTTTGGAGGCCTCGGCATTGACGAATGCTGTGGCGTGGGCGATCACGGTAGGAGCA
GACATTGGCGTTGTTACGGCCTTGAGCGTGTGACACAGGAGGTCCGATAGTCACTAGAGCTCTCTCACCCTTGATTGCAAAGGTATATGATGTGCCCTTG
GCCAAGGTGTAGCGCTCTTAAGCTTGAAGATCGCGAACCTTGACATCATGCTCTGTTTAAGGTCTTCAAACGGGATATACTTCCGCTGGCCCTTCCAGAT
GTGTCCTTCCACGACTTAAGTATCGAGTGCAACAGGTAGATATACTTCTGTCCCTCGGTCATCACCTATTCGGTGGCTTCTGACACTGCTTTCATCGCGT
TCTCAAGCTTGAGAAAGAACTCGGTTAAGTCGGAGCCTTCCTCATACTTGATTTTCATTAAGTAGTGTTGAGTGAAGTACGGATCACCATCAAAGGCGGC
TGCCTCGTACGTCTGGCAAATGTAGTTGAATATCGTGTAGGATGTCGTGAGATTCTTGACCAGCCGCGCGTGCATGTTGTCCATCGTTTTCATCAAGAAG
GCTTTGGTTCTGGCTTCTTGTCGACAGCGTTCGCGCTGGCTAAGAGACTGGGGCTTCTCTTTCTTGGCTCGTTTGCGTGCACGGCGAGCCTCGCGCTGGT
TAAATAGTCGAGCAACCGGGAGGTCCTTTCTCTTGATTGACGTATTGGAGCTGGCACCAGAGTCTTCATCCGAGATCGAGGGCGGCTTGAGCTCGTCGTC
GCTCTCGTCGTAGTCCACAGTGTTGGAGTCGATTTCAACGTTCTTAGTAGCGTTGGCATGCGGTTCATCGTTGGCGTTAGACATATCGCTGCCGCTGTCT
TCACTCTCGTCTTCAGACGCACCATTGTAGTCAAGCTGCTTCACGTAGCCGAGTAGATGCTTGCCATCTAGTGCTGCGCACACACGGGTCTTCCAGACAT
CGAAGTTCTCGGCGCCGATGAGGCTAGGGAAGTTGTCGCCCGAGGCTTGAGGTAGAGAAGAAGAAGATAGAAGAAGAAGCTACGTATTGGCGTTAAAAGA
CGAAGTGAGCACTTTATTAGTCTTAGGAAGCCACTAGTAGCTGCACACCAGTCATTAGTGCTAGTATAGTCTAAGCCAGTCATAACGGCTTAAGTAGGAC
CTCCTACATTTCATTATAATATCTTAGTGAAAAGAGATTCTTTCAAGAAAATCATACTGTTTAGAGGTTACTTCAACAAGCTGGTAAGACATGCCGGGCC
GTTTTTATTGTGTCTTTAGGTCTACTATCTAGGCAGCAACGAGGAATATGTTAGGGATACAGATTGCTCTACAGAAAGCTAACATCAACTGCTCCAAACT
TGAGTTTAAGCATGATGTCCCAAGTGTTTTAAGATTTTATTCGTTATCATAACATAATTCCGACGCCGTTATCCCGAAAACCCTGTCGGAACTGGACCGT
TTTTTTGGGCCAATACACGTCAGTTGAGAGACTTAAACGAGTCTGATTAGATTCTAGCTGCTCTCTGTTTTGCTAGAAGCAGCAGATTTATTCTAATGTC
GGCGTACTTCGACCCACAGTAAGTGCATTCAGGACATGTTAAAAAATAGCCGTCAGGGTATTCTACGCATACCGGATTTTAAGTTTTTGGCTGCTATTTT
GAAACGACCCAGATTGTACTAAAGTCGCCGTATACCCTACTTGAGTGGGTTCTAACTCCAGCATTCAGGGAAATTATGAGTTGAACACTTTAAAAACATG
TAGTAGACGATAAAAACTCAAAACTTTTCCGATAAGGTAAACTGCCAGTTTAAGTCAATCGAATCAGATTAAGACCTACCAATAGCAGTACAGATGCAGT
GGATTGTCTATAATCAGAAAGGCAGACGATTCTACTTATACCTCCCAGTTTCGATCTCGCTTCCAACCGCTTCCAACCATGAAGTGCCGCAAGACTTACA
GCAAGGAGAAGATGGACTTCGTAAAGTCAATTCGAGAAGGAGGCGACATTGACGGCATAGGGAGGCAAACTGGCATTCCTGTCCGAAACTTGCGTCGATG
GGTTGATGAAGACAAAAAATGGCGTGAAGTGGGGAATGACGAGCCTTACTCGTTTAGAAAACGACGTGGGCCAGCGCCTGCTCTATCCAGGGAAGCTGAA
ACCAATATGCATGAATGGTGCGTTGGCCAGCAGGTTGATGGGGCTCCTGTTGGAAGGAAAGATATCATACGGAAAGCCCAGCAGATTTCTAAGTTGGCTA
ATGATCAATTAGTAGTCGAGGGATGGTATCGCCGATTCAAGGACCGTTATCCTGACTTAAGATCTCGGACTTCTCAGTCAGTGTCAAAGGTTCGCAATAA
TGTGACTGAATTGGAGGTGGCTGCACTTTTTAGGTCGTTGGCAAAGGTCATTGTGAAAGAAAATAGGTGGTGGAAGCCGCATCTACAATACTGAAGAAAC
TGCATTTGAGAGCTCCCGTAAAAGAACTGATGTGGTAGCTCTTAAAGGGTCGAAAAGCGTTTGGCAGGCTGATTCCACGACAAGCTTCCATCTCTCTATC
GTGGCGTGTGGCAGCGCTAGTGGGTTTGTCGTGCCACCGTAGTTCATATTACCTAGCGAACGAGTGGAAACGGAAGTCCGCAAACTGTGCAGTGTTCCTG
AGGCAGCAGTTACTACTGCTACAAAGGGATTTATGACAGCGTCTCTTTTTGCTAAATGGATTAATTTCTTCGCTTTTTCTGTGTCAAAACGTCACTAGCT
CTCGTCATGGATGGCTGCACATCTCATATTACTGACGAAATCGTCATAGCCGCTGATCGGATGCTTGTCAAACTGGTGTGCCTCCCTGCAAACGGCACAC
ACTTACTGCATCCGTTAGATGTTGCGTTTTTTTTTCATTTAGAACACATTTCGCGATCTCATCGACGCGGTGGTTTGTGCGAGCGGAACTAATACTATCA
GCAGGAAAAAGCTCTTCAAATGGCTACATTAGCATGGACAAGTTGCAACTTCGAGCAAGATATTTCTTCTGCCTTTCGGAGCTGTGGGATTTTCCCGTTG
AATCTTGTAAAAATGCACGAGAAACTCCACAACTACCAACACAACGGTGTTTCTGCCAGCCTTAAAACAGCTTCCTGATTAAGATACAAGGAAACAGTGT
CACGACATCTTACTGCTATCTGCTCGTCAACGCAAGCAGAGTAGAAAACGAAAAACAAAGACAGTAGCAGGTAGACTGCTAGCACGCGAGATGCTCCAGC
AACCGGACCAACACTCCGAGCCAATGACCCAGAGCCAAAAACGATACACAGCGAAGAGTAGGAGAGCTACAAAAAAAACCGTCGAGAGGATAGTACCTCG
AGGAGCAGAAGCAGGAGCAGGAGCACGACCACCAGCGCGTACAGACCCAGGACCAGGGGTATGAGCTGGAGCTGAATGCAGAAGTGTCGGCCCAACAAAG
CAGCGAAGCCGAAACAGTTATGTATGTCGTAAGGTTGTAGATGTTTTTTTTAATACACTCCATTCTTTGATCGTACTCGTGATTATCATTTTATAAGGCT
AAAATCGAAATTTGCAGAAATTCCAGTGTACGTTTGAGATCGTGCGTAAAACGTCGTCGTCTTTACTAAACTCAAGTCAACTTTGGACTTAAGCTGGCAC
ATCTGCAAAATGGGCCCAAACTTTAGGCCGCTACTACAAACTAAAAATAGCTCGTTCGCGTTGCTTCGCACCACAAGACAATGTTGAAATCCTGATGGTT
ACAGACGTGTTTGTAAAATGATCGCTTTCGATTCCGATGGCAATTTACGCGCTCTCAAACTCAACCTTCTGTCACGGACTTAAACTGGCAGCTTACCTTA
ATATTGAAAGAGTTTTGAGTTTTTCTTATCTCCCTGAGACCGCGCAAAACAAAATGATACCTAGACGGAACTCGTTAGACAAGTGTCAGACAAATGAATT
TGTATTAAATTGGAGAGGTGGGTACAAACGCTGAATAGATGGGTACAAAAGAGAAGTGGTGTGCAACATCGCTCTCTTTGGTGTGTGACGTTAACGAGCT
GTTGTTTTTGCTTTCTTTCTTAGCAGTTTTTCTACTGTCGCCCAACTGAGCTGCCCGCGACGTCGTTTGCGTGACTTCTCAGTAGTTTCGTCAACAGCGA
CGCTGGTTAAGCACCTGAGTAGCGCCATCGATGGTATGGCTGCGACTGAGCAGAACTTTCGATGCAGCATTGCTCTCAATCTTGAGCATCAGGTAACGGA
GCTGACTCAGACGCTTTTGAATCATCCTGCTTGGCATATCGCGGCCGTCAGGTAAGCGAAGCGACGGTACCTGCTTAGCCTTGTTACCACACATCCAAAG
CACCCATACATGACGAACTGAGCTATCGGTGACAGTAAAATCAGCGGGTACATAACGAACGGAGCAATCGGGGACAGTAAAATCAGCGGGTACACGACGA
AATTTTCCCTCGCAGTAGTGATAGAGATGGCGACTGCTATCTTCAGTGGCACTGTCGACGACAGGATCATGTCCGCTTGTTAGCTTCTCTACAAAATCGT
CAACGCCAGTATCGTGAAGACACGCTCTAATTGCATCATGAAAACCGTCGTATGTAACAGTACCGGTACCGATAGCACGTTTCTCCAGCTCAGATATAAT
GTCCTGCACAGTATCAACTCGCGTAGCTTCAGGTTTTTGCTAGCGCGTCAAGCCGCCCGTCCTTCAGACCTTTCATTTCACACAGTATCGAGACATGGGG
TGGTACTTCTGTTGGGCGAATACGAGCTTCAGTGCACCCATCACATGTCCTAATTCGGTCTGTCAGGCCTGATAGTAGATCTCCATCTTGGAAAAATAGG
CGTCTCAAAAATGTGGTGCTGTGGAGAGAGAGTATCGTTCAGGAATGACGAATGGTAGACCAACGATGCTAATCAGTACTCCGCGATGTACTCGAGCTTT
TAGGTAGGGCTCGAAACATCATTTTCATCCCGATCTCAGCACCCTCGTCGCGTGAATCGAAATGTGGAGCTAAGGTCGAGAGCTTGTAGCTTTAAGTAGG
AAGATCTGCAGCTGTACGACCCACGTGCATGTCGTCAGCAGCCTCGTAGCGAAGATATGTGTTCTGTACCCTCCGAGCGACCAGCAAATGGAGGGCAGTA
GACGGTGGGCGTGCAGTTGACCCTGAAGAGCAGAACGTGGCTGAGCCTTTTCGCATTGAGTGAGTCCCCAGTTCGGTGGCGTTAAGACTCTGACGCTGCA
ATTCGGTGGCTACATCCTCGTGTCCAATAGACGCAGCCAACACTTTCTAAAGCGCTCGTACTGGCTGCTGCCGGGGAAAAGTAGGTCACTACGTCAAAAT
TTGAACCGACCAATATAGTCCTAAAGCGAGGAATAGGACCAATACTTGGCTGTAGCGGGTTGGCGTAGATATGACGAGAGTCACGCAGTTATTTACCACC
TTGGTCGTTCTTCATATGAGCGAAGTAAATCTGTAGCGCATCGCCTCTCCACTCCATATGTGAATGGCGTATTTTAAATGCGTTGGAGGAGCGGCACATG
AGATTCCAAGCAATTATCATGTATGTGTAGCAAAAGCCATCTCCTTGCCTGCATGAGTGAGCTTTTTTTTGCACAGGAAGGAGTACAGATCAAACATGAG
CGGATCCTTACCAGTCATGACGGAGGTCTCACCATTAGCTGCGTCCTTCGCAAGTTTATGCTTGAGCCCTTTGAAGTGGTTTGTGAGCTCTGACTCTAAG
CGCTTGGGCTTGGTGTGGCCGTAGTTACGAAACAAGTTAAACAGCCCTGTCCGATGCATGTTCAGAGCGGAGTAGCTTAGGGTACTGCCATCCTTTCGCG
CTAGCGTCACAAGCCATGTAACAAAGTCAGATGCGTCTAATGCCGCAAAGTCCAGTGGGGGAATACTGCGGCTCTGAAAAACAAATTCTTTGATACAAGA
GCGTAGTTGTTGCAGCGAGCACTCCGTGATATCACCAAGGCCCTCGAGAAGGGGCCTGGGTGCGAGATGCGGTTTGTGGCGGGTAACCCACGCCAGAAAA
CGACTGTAAGAGTTCTGATAAGTGGCTCTTGAGCGTGCAGTCACTGTGTTATCGCGGATATCGCGACCTGTTTGCTTTAACGTTTGCCAATCGTAGCCTT
CCATTTCCGGCTCGACATGCGGTCTGACTTCTTCGGGGCGAATTGCGATTTGCTGTTAGTGTACTACAAAACAAAACAGGGGAGAGAATTGAGATCTTAG
AAAATGTCAGACCTTCTGTCTAACGCAAACACTTGTGTGTCCCACATTGTCATACAAATTTTGGGGAATGATACTTACGAACCATTTAGAGTTGTCGAGA
TAATCGAGCTTAAAGTTGGCCAATTGATTTCGCACATAACCGGAACTGTAACATTTGGCGTAAACTTCCATCGAAAAAACTGTAAAACTATTAATACCCT
TATTCAATTGCTTTTAACAAGGGCTTTTAAATAACACTTGATTTTTTTAAGTAAAAAAATATTGAGCTCACAACACTCCTAAATGTATCGTCATTTCGAG
GGCCCATAAATGGAGATAATATTTTTGTGCGAGCACAACTTCTTCAGATTTAAGCATTCTGTACCTTTTAAGGGTCCAAGAGATGGCTTAAATCGCGATT
CGTACTTAGGTTCGTAAGTGTCATTTTGTTTTGCGCGGTCTCAGTTTTTTTTTAAAAACAATACTTCCACAAGTCTTAAAAATATCAAAGGGGTTTGAAA
TGATCATTTTAATTAATTTGAAAGGGAGCTTTTATTTGGGTGAGTT