Description :
From Genome Similarity Track
Location :
Scaffold_1069:6948- 8031
Transcript NameFunction/comments
Phyra_86696zinc finger protein, predicted

Sequence
1083 bases(100 bases per row)
CGTTCGCGTCAAAAGATCCGAGCACGATTCCCGCTTCTTTCAGCATACGCATCAGCAGTTTCACCGCCTCGAGTTGGCTGGTTACTTCCTTCGGTGCCTT
CACTGGACCTTCCAGTTCCCCAATTGGCTTCGGGCGCACGATCTTCATTACAGGATCTTCGTGCAGGAACTTGTACAGGTCCTTGTAGAAGAAGGCAGAC
TCCAGTTGCTCGTCCGTCCACGTGTTGCGATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCT
TCGAGGTTGCGTGCGGAACTGGAGGAGAGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGGACCTTTGTGGAGAAGTGACCAGAAGTTTTTGGAGAT
GGATTGATCGTGTCCGACCAGTTGATTGGGCGATGGGTACGGATAGATGGCTTTGGACCTGGGCTGGGCAGCATCAACGGTCGGACGACCGGATGGTGAA
TGTGAAGACCATCATTCCGATCTTGGCAGATTTGATCGTGGTACCACATGTTGGGTACATGAGTTCAGATCAACCGATCGGATCAACATGGGTTCCGATC
GACCGATCAGATTGACATGGGTACAAATCAGCCGATCAGATCAGCACGTACCACAAATACCGGCACATCGGAGGTCCAAGAATGTCAGCAATCATGAGAT
ACGCAAGAGAGATGGGGGATAGGCACGTAGTTCTAAATGGATAAACAGAGAGAGATTTTCCTTGTAGCACGCAAGTGGTCTTCCGAATTCCGGGGAAGGA
AGTATATTGGCCTACCCGACGACCGGACAACCACCTGAAGTGACTCAAGCGAGAACGCGGAAGCCCCTGGATAGCTTGGCCAGGTGCGCTCCCCTTCTCC
CTCCAACTCATCAAGACCCCGCCATAGGAGGCGGCAAGCATCGAAAAGGACCCCGTAAAGGACACACCCCGTGATCGATCACACACGATCGACACCCGAA
CCGACTGCTGCGTGAACTATATCCGCGTGGCAGCCAACCACCCCCCATCCCTGAAGGGCCCTCAAGCCCCAGTTCTGCCCTGT