Description :
From Genome Similarity Track
Location :
Scaffold_7:69469- 74943
Transcript NameFunction/comments
Physo_353731predicted protein
Physo_356740AlNc14C58G4351
Physo_549212Hypothetical protein
Physo_348853PREDICTED: alpha-tubulin N-acetyltransferase-like
Physo_517199Hypothetical protein
Physo_518679Cation Diffusion Facilitator (CDF) Family

Sequence
5474 bases(100 bases per row)
AACTGTCCTCCTGAGCCTCGCTTGCCGCAATTTGTACCTGCAAGCGATAAAGAAGAACATCAGTACCTGTGTCTTATAACGAGGAGGGTGGTGATGATCG
TTATAGCCTGGAACTTACAGTACGGGTGGGCCTTGACCAGCCCCTCGGTCTGCTCGGGCCACTGCGTCTGCGCCTTGCGGCAGATCGGGCACTTGTCCGA
GTTGGCCTCGTCGTGGTTGACGTTCTCCAGCAGGCAGCTGAAGTGGAAGCGGTGGCCGCACTCGGCCGTGAACAGCGCGCGCCCCAGCGCCAGCTCGTCC
AGGCAGATGACGCACTCGGGGGCGTCCTCCATCACGGCCAGCGGCACGTTCTTGGCGCTGTCGGCGGTCGGCGCCGGCTCGGCCGACGCGGGCGCCACGG
GCGCGGGGCTCGGGGTGCTGTTCGCGTACGCCGCGCGGTGCAGCGGCCGCTGCCGCGCCTCCACGTCGCTCCAGCGCCGCACGCGCACCGCCATTGTCGA
GCAGCTATACAGGCACACGGGGCTTCTTGCGTTGTGCGGGAAGAACAGAATCCAGTCTGGTACAGAATCAGGATTAGCCGAAAAACTAAAACATGACGTT
TCGGAGGTGGTTGACTATGCAGAAAATGCATTTTGTAAGTGTGTAACCGCAAATTGCCCAACTTAGTTTGCCGCTTGCGACCATATTTCCTGCGCTAGCT
CTTCTCCAAAAATGCGCCTCGCATCGTTAGCCGCTTCGTGGTTTCCAATTCTCCAAGCTAGAAAAGTGTGGACGCATGGCGTTCCTGCAGGTAATGTTCC
CATACACCATGCGGCTCGTGAACATCAAAATCGTACTGCACTGCCCAGCAGTCTCGTTCGCATCCCCGCTTCAAGACTGGCGCGAGTTGAATGTGACAGT
CCCTTTCGAACGCAGCAGTAACGCCTTCATCAAGTACAGTACATGTAGTGGTCGAACTGGAAGAAGATGAAGGTTGGGGTTAATAGTCGAAGGTAAACGA
GCTGGAACTGCGCAAGCTTCTCAGGTGTGGCAAGCATAGTTTCGCTTACAATGATGCGGCATTGCAGTTTGACTAGCAAGCACGTTCGTTATTGGTACTA
TACGAATTGTAGCTTACGATAGCAACTCCTTGTGAAGCCGTACAAAGTAGTGTGTGTACCTATGATAACCGAGAGAGAGCCCTCTATTCGAGTGCCCAAC
TGTATATGTCGCAGCGATGAGCAAAGTGGTCCCATCCTCCCCAAACAGGCGGTGCGCCAGGAGCTCAGAAGCCAACGAGCTGCGCAGACACCGCCACCTG
CACTACACCACCCGCTAAAGCCACAATGGGCGGCACTCTCTCCGTGTGCGGACTAGGCGACCGCGACGCGCAACTGGTGAGGACCCAAGAACATCCTTAC
CCTTGCCATTACCCGCTCCAAACTCTAACTCCATCACGACTCGACTCTAACCACATCAGCACTACCAGAGCAAGGACTTCGCGCGGGACCTGGAGCGGCC
GGCGCAGGCGCGCGGGCGCTCGCTGTCCACGGCGACGGACTCGTCGGTGGCCTCCATCCTGTCCAACTCGGAGCAGCTCATCCCGGACGCCTTCCTGCCC
AAAGACATCCAGGTGCTGTCGCAGCGTCGACAACGACTGGGCCACCACCACTCGCGCTCGTCCTGGGGGTCGTCCAAGGTCGGCAGCGCCTCGTCCAGGG
GCGCGGGCACCGTGCGCGTGGTGCGCAACAGCAGCAAGGCCGTGGACGTGGCCGACTGCTCGCCGGGCGTGAGCGCCAGCCTGCGCAAGAAGACGCTGTT
CGGCATCAAAACGGCGTCGTCCAGCTTCGGATACAGCGACGACGAGGGGAACCCGGCGGCGGCCGGCAACAGCCGACTCCCGGCCCAAGAGCTGCGGGTC
AAGTAGACAAGCGGAGACAAGGGGAGGCACTGTAGCAGTAGGACAAGCAATAGGGTGTGAAGTAGTGTACTAGTAGATAGAGGACGCAGGAAGCTAGCTA
GCTATATCCATAGAAGGCGAAGGCGAAAGGTTAGCAAGCAGGTAGTAGGAAGTAGGGAGGGAGGACGGGTTGTATGAACAAGGCACAAAAGCTGTATTTG
CGACATTCCGCCCCCCCCCCTCGCTCTGATGAAATGGGGTCGGGACTCTAGGCTTGTTGCTTCTTGACGGCGGCCTTGAGCTCCTTGACCTTCCGTCGGC
ACTCGCGGTAGGCCTCGCTCTCCTGCTCGCACTCCTCGCCGTCGCGCAGGCCGCCGCTCTCGGCGTTCTTGGCTTCTACGCACCTGCAGGACGTGACGTG
AGTCTCCTCCTCCACGGGATTCCACGGGCTCCTCTACACCTCACAGGCACACGCAGACGCGTGGCACTATCACACTCACTTGACGTAGGTCTCCATCTCG
CCCGCGCACGGGTTCAGCTCGGCTGGCTTGGACAGTTCGGCGCCCATGACTCCCTTCGAGCTGCTCTCTTGGCGCTTGGGGACCGCAGATAGACACGCTG
TCTTATGTAACAAACCGCTAGAAAACGGGCGTCCCGTTCGCGCCGACCGCCATGCGGATTGAAGTGGTGCGCGCTCCCGAGCCGCTGGGCCCCGCGCTGG
CTGAAGCAGTCGACGCGCTCGGCCGGCGGTCCGCCCTCGTACGTGTCCATCCCGCCAGCCCATCGCCGGTCTTGACACTTCGAGGCGATGGGCTCTAGAT
ACGGTACACACAGTGACCTGCATCTTGTCTGCCCCAGGCCCAGGCTCTCTCCCAGGAGATCACCTCGGTTGCGCTCTTCACGACGCCCGGGGCGACGCAA
CAGCGCCAGCGTCTGCTACTGGCTAAGGACGATGATGACCGCGTCATCGGATTCCTGAAGACCGGGGTCAAGCACCTATTCTACATGGTAAGAAGATGAC
TCTCTGGCCCAGATGGCTACATCCTGTGGACGCTCGGTCACTTGTTGACGTTTGCTATTGTTGGCTGCTTCTGCTCTATGTATGATATTCTAGAGCCACA
CGGGCCAGTACATCGAGATGGATCCGCTCTGCGTGCTCGACTTCTACGTGGACGAGGCCTGGCAGCGTCGCGGCGTGGGGCTGCAGCTCTTCCAGCGCCT
GCTTCAAGACGAGCAGGTGACGCCGGCCCAGCTCGCCTACGACCGACCGTCGCCTAAGCTATTCGCCTTCTTGAAGAAACACGCCGGTCTCACTGAGCAC
TTCCCGCAGCCCAACCGCTTCGTCGTGTTCGATGCGTATTTCCAGTCTCGTCAGTAAAGCAGATCGGATAATAGAAAACCACTCGCTGTGATAAGGCCTG
AGCGCACGTCTTTCGAAAGCAAACTCACCTCGTATTGCTGCGTTTACTCACCAAGGGAGGCCAGGAACGCCTCGACCTTGGTGTCAGCGTCGCTGGGGTT
CTCGGCCGTGGCCTGATCAAACTGCGCCTCAATCCGCCGCCCAGCAAACCACCGCCCGTTCATCACCTTCAGACACGCGATGGCAGCACTCAGCTCTGCA
AAACGCACGACCACCGAGCCGTCCGCTACAATTTGAACGCGCTCCACTGCTCCGTGCTTGCTGCATTCCGAGCGCATGTCCTCCTCCAACTCGTCGAAGA
ATTCAGCATCGCTGCCCTCGAGTGGGTCCCATATATGCTTCAAGATGACGGAGCGCGACGGCAAGTCCAAACGCGCCGAATCATCCGCCGAAGCAATCGC
CAGCGGTGCTGGTGCTGCAGAGGAAACTTGCATTTTCTCCACCGGTTGAGTAGCAGCTTGCTCGACAGGCGCATTGTCCGTGGCTTCCTCTGTGCCCTTC
GTCTTCTGGTTCGAGAACGTCGCCTCAGTCGCCCTGTGTACACCAGATCCTCGTTAGCGCCAAGTAATTCGTGCATCAGAACACAAGCTCACGTAGCTAG
CGTCTCGTACGTGATGATCACACCAGGCTTGACTTCGAAGTGATTCAACTGCAAGACACGGAACGAGACGCGTATGAGCAACACGCGCAGCAACGCTCGA
ATCCAAAAGGAGACTCGCTCTGCTTCATCCTCGTGCGGCTATACATCAACCCAGCTGCAGAAATCTTTAATGGTTTTACCCTGTCAATGGCCTTGGCCAT
TGTAGCACGCGAGCAGAACGTGACGACTGCATCGCCCTATATCCACATCCAAACAAAAGGATCTGAGCAACCCACCCGGCACGACCAAGCAGCAAGTCAT
CCCCTCCTACCTTCAGTCCTCCTCTTTCGTCCTTGTAGAACTTGATGCGCCGAACCTTGCCGATCTTGGAGCACACGCCCTCTGCAAGACAAGCAACCCC
CTCCGTCAACCATCACCCCTGGCCTGCAACTCCTCAATCATGGACTGACCGAGCTGCCTGCACGCCATGTACGTGGTGAGGCCCGTGATGTAGACGCTGC
TGTTGCCCTTCGAGCCGCCTCCCGTGGGCGTGGACCTCTTGGCGCTGGGGGCAGCAGCAGGAGATCCGAGCACGGAGGCCAGCAGTTCGTCCGCCGCTTG
CGAAGCCTGCCGCTCGTCCTGTCTGCAGCCGCATTGGCGCGTTACGAAGGGGAGACACGGATCAATGCAAAGCTGGAGGTTGGGGTGCGCACTGCTGGAT
GTAGGCGAGGTTCCTGGCCCTGGCGCGCTCGATGCGCTCGCGCTCAGCATCCATGCTGGTCACGTCGCTTCAGTATTTTTTGTCACTGCAGTCACTAAAG
TGAAAGATAACGGCTGGATGATGATCATTGGTTGAAAGTTTCTGTAGACGAAAAAGGCAACTTCAACAAGTGTTGCGAGTCTGGCGTGCCCTGACGCAGC
GTTGCGTTAATTTCACACTATTGGGCCGCGCCCTGTAGCTGCAGGGTCCTCTGAATCAGGCGAAGCGACTTCCGTTTTGATACAGGCTACGTGCGTTTCT
GTTAGCCAACGCAGTCGTCTCCAAGTCCACTCGAGCACCGCAACGACGGCACACGTACCCCCCCCCCCCCCTCGTGTAAAATCCAACTAACGCGATTCAC
TCGGCATCGATGTTAGATGTTCGTTCACTTGGCAAAATGCCATCAGCAGCGCACGACAAGACCAGCAGATCGACCTCCAGAGGCTGCGGCCGCACGCTCT
TCTGCATGGGCTCGGACAAGTGCTCGCCGGTCGATGACGCCTTAATCGACTCGCCACGCCGTATCCCGCTGACCGAGAGCGCCAGACGCGCCCAACGGAA
GCTGCAGCTGGCCTGCCTGTGCTCCGTCGTCTTCATGTGCGCCGAGGTCGTCGGGGGATCCATCGCCGGCAGTCTGGCCATCATGACGGACGCCGCGCAC
TTGCTGTCGGACGTGGCCGGCTTCTGCATCTCGCTGTTCGCGATCTGGATGAGCACGTTACCAGCTTCCAACAGTTTGAGCTTCGGTTTCCAACGAGCTG
ATGTGATCGGCGCAGTGGTCAGCGTGCTGTGGGTGCTGACGGGCATGTTGCTGTACGCCGCTGTGAAACGATTC