Description :
From Genome Similarity Track
Location :
contig_130:69467- 72584
Transcript NameFunction/comments
g11551.t1hypothetical protein

Sequence
3117 bases(100 bases per row)
CTTCTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTC
ACCTCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCT
CGACCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTT
CTTCGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACC
TCGCTCGTGGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGA
CCGTCTCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTT
CGACTTGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCG
CTCGTGGACGGCACCTCCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTC
TCGGTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACT
TGGGCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGT
GGACGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCG
GTGGTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGG
GCTTCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACATCTCGGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGA
CGGCACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTG
GTCACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCT
TCTTGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGG
CACCTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTC
ACTTCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCT
TGCCCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCAC
CTCCTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACT
TCCGTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGC
CCTCCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTC
CTCGGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCC
GTCACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCT
CCGTCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTC
GGTCGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTC
ACCTCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTTGGGCTTCTTGCCCTCCG
TCACCTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGT
CGTCTCAGTGGTGGTCACTTCCGTCACCTCCGTCACTTCCGTCGTCTCCTCCGGCTTGACGTCGGTCGTCTCGACCGTCTCGGTGGTCACTTCCGTCACC
TCCGTGGTCTCCTCCGTGGTCTCGTCCTCGGTCGTGCCCGCAGTCGGCTTGCGCTTCGGCTTGCGGTGCTTCTTCGACTGGGCTTCTTGCCCTCCGTCAC
CTCGGTCTCGTCCACAGTCTCCTCCACGATCTCGGTCGTCTCGGTCGTCTCAGTCGTCTCGACCGTCACCTCGCTCGTGGACGGCACCTCCTCGGTCGTC
TCAGTGGTGGTCACTCC