Description :
From Genome Similarity Track
Location :
Scaffold_138:6946- 8525
Sequence
1579 bases(100 bases per row)
TTCACCGCAGTTGTAATGGGCCCCTCCATTACATAAGATTTCTTTACAAAAGTAGGTACATCAGCACACGACTAGCGTGTGCAGAAATGCTGTCATGCCA
TTGGCTGATATATGGGGAGCCAGACCCATTATTAGCCAATTGGACTATGACGTGTATTTGAGTGGCCAGGGCTGTGGCCTTGGTCCTAAAATAAAGTCAG
AGTTGATTTTTCCTTAAAACCTAAGACTCAGTCGTCCTATTGCGAGCTTCCTCAACACTATAGTGTAAGCAAGTAACGGAGTAAATACCTGGGCCGTTAC
ACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCACGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAG
CTCTCCACCGCCTTGCGGCGGTGTCCGGAGAAGCCGTCGTCACGTCGCTGCTGCGCTCAGCGACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCAT
GGAACGCGAGCTCGCCGATGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCTCCACGAATGACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCC
GGAACAGATCGACTTCCGCTGAATCGCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCC
TCTCGAGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAACGTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCG
GCTCGCGTTCGAGCCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGCAAGGCACGATGACTATGCGCGACTACGTCCAGAAGACA
CGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGTTCATGTATTCGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTGCC
TTACAAGATCGGACCCCTCTACGCTCGAAGAGGCATTCGCCCTCGCCCTACGCGAGGACTACGTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTC
TGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCAATCGTCAGCGTTATGCAGCGCGTCAGAGCGGTGCTCGGAACAAT
CGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGA
GTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGC
CCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCATTGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGC
GAGCGCTCCTTGATTCAGGAGCGACCAACAACTTCTTCCGCGCGTCGTGCTTGTCGGTACTCCCGTCGGACATCACTGT