Description :
From Genome Similarity Track
Location :
Scaffold_5:694597- 695903
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002415candidate polysaccharide lyase related to fungal pectin lyases
Pytul_DAOMBR144PYU1_G002414candidate polysaccharide lyase related to fungal pectin lyases

Sequence
1306 bases(100 bases per row)
TGGAAGCAACGTCATCGTCCAGAACGTCCATATCACGCAGCTCAACCCTCACTTGGTGTGGGGCGGCGATGCGATCGACATATCCGGTGTGAACAACCAG
CCAGTTGAACGCGTGTGGCTCGACCACATCAAGGTGTCTAATATCGGTCGGCAAATGATCGTTACCCACTTCGCGGGCGTGAAAAGCTTGACGATCAGTA
ACTCTGACTTTAATGGCCAGACCAAGTACTCTAGTTCTTGCGATGGCCGCCACTACTGGGGTTTCATTCTTGGCGGCAAAAACTCTCGCATCACCATGAT
CAACAACTTCGTCCACTACACCTCGGGCCGGTCACCAAAGCTCGGTGATGGCTCAAACCCCGCTTTGCTCCATGCCGTGAACAACTACTGGTTCTCAAAC
ACCGGTCACGCGTTCGATATCGGTGAAAAGACAGTTGCGCTCGTCGAAGGCAATTACTTCGACAGTGTGACGACTACAAACACCGACCATCCGTACGGCT
CGATCTTTGTGCCTTCAAATGCAAACCAAGCACAATGCCAAGCCGCGCTTGGCCGCAAATGCGCGCTGAACGTTCTGATCAAGAGTGGAGCACTCAAGGG
GCGCGGCGAGAGCAGTGTGACGAGCCAAGTCAAGGGTGTGAAACAGATCAGTGGGGTGAAAGTTGCGGCAGCGAAGAAGTTGGCGCTCGCCACCGGCAAC
TTTGGCGTCGGAGCGCTACCATAAAAGCAATAGACTGATAGTGCGTATGAACTGCAGAACGTGCGTGAATCGTGAGCGCGTAATAAAACATGCTTCGAGT
GTGGATGACTGAATTGCAGAAACTTAACCGATGTTTTTTTATTCACGATTAAGGGAAGGTTCGTCTTGTGTTCATTCGTTCCATTTCAGCTATACTTTGA
AGCAGTATGCTGTAACTGATCGTGAATTGTAGTTCATTGTTGTTGAAGGTATAGAACTTATCCAGCAGCGCTCTATTGAGAAGGTCATGGATATTATGCA
ACAAATTCAGGCTACGACATTTTCAGGGTACGAAAAGAAAATCACCTAAAACTCAATCGGCACGAAAAGTGACCACCAGCAAATCGAATTACTTAGGCAA
GGGAACCAACGCCAAAGTTCGTCGTTCGCTTTGGCAGCTTTTGAGCCGCCTTCGGCACGTACGACTTGATCTGCGAGAACGCCTTGATGCCCGACAACAC
CTCCGCGTCCTTGCGGCCCACCAACGCGCCACTGGACGTCACAGTGTTCGCAACACACTTGCGGCCCAAGTTGGACTGGCACAGAGCCTGGTTGCTGCTG
CTCGGC