Description :
From Genome Similarity Track
Location :
scaffold_803:6945- 8222
Transcript NameFunction/comments
Pl_102350serine protease family S10, putative

Sequence
1277 bases(100 bases per row)
TTTGCGGATACGAGGAACAGAGCGCAGGTTATATCCGTCTCCCGAACCGAGTTGATACGCACTACTTTTATTGGTATTTCGAGTCGCGCTCCGAGCCAAG
TACCGATCCACTCATTGTGTGGCTTCCTGGAGGTCCAGGACTTGGTGGCACTTACGGGCTCTTGGCCGAAAATGGACCATGTACCATTAACGACGACCTT
TCTACGAAACTAAACCCATACTCTTGGACTACTAATGCTAATATGGTGTGGATTGACCTTCCTGCAAATTCAGGATTCTCCTACTCCACTGTTGCAGAAG
ATGACGAATTTACCGATGAACGTGTGGCTGAGAGTGTGTTCTGGTTCCTCCAAGGTTTCATGAAGCAGCATCGGGAGCTACAAGGACGAAAATTATTCCT
TGTGGGAGAAAGTTATGGCGGACATTATGTGCCTAATGTAGCCCACTACATTTGGAAGAAGCAAGGCGAACATCTTTTTTATTCCTCCTCGGCTGAATCC
ATTCCAATCAATCTTCAGGGAATTATCATTGGAAATGGACTCACTGATCCTATCGAGGTTTACACCCACTCTGCAGATATGTCCAATAATTCGTTCAACA
TCCAGCTTGTGAACGATACTCAATTAGCATCGATGAAGGCTGCAGTTCCGGAATGTCGAAACTTACTGGTTCAATGTCAAACGAACACATCGATTTGCGG
AGATGCGGGCTCCTACTGGCTGCGTACACAATGGTTGCCACTTCTGGGAAGCCATCGAAGCCCATACGATATTCGCCAAGAGTGTAAAACGTCACTTTCG
AACATGAGTACATGTTTGCTCAAGGCACCCAATGTAAAGGCATATTTGGATTTGCCCAAAGTCCGTGAAATCCTTGGAATTTACCCAAAACGCAGCGAAT
GGAACTTACTCAACAGCACAATCAACGCAGGATTCTTTGGAGCTCCAAGTTATTCTGGATTCAAGTCCACAGCTGATAAAGTATCTGATCTACTCGAAGC
AGGGATGAGGGTGTTATTCTATGCTGGGGACGCTGACCTCTTGTGCAACGTTTACGCTACCGAGGCAACGGTCGAGAACTTGAACTGGTACGGATCTTCG
GGTTTCAATTCTTCGAAAGCTCGTTCGTTCACAATTTCCACGGGAGCCACGGTTGCCGGCACCGTGAGATCGTTTTCTCAGCTGACGTATGTGAAAGTTC
ACAACGCAGGCCACATGGTCCCGGGAGATCAACCGGAGGTCGCCCTCGATATAATCTCTAAGTTCATTGGAGAGCAA