Description :
From Genome Similarity Track
Location :
Scaffold_210:69441- 77445
Sequence
8004 bases(100 bases per row)
CTTCCTCTTGCGCGAGTTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTCG
TTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCT
GGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGAAGAACCTGCAGGCTCCG
GCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAG
TAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCAAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTAGGTGTACAC
TCGGGAAGCAACATCCCCTGGATGTTTCGCATCCTGGACTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGT
TCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACTGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAACG
AACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTAAAGAGGCGATTCA
AGTGGCTCTTCAAGAAGCGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAAC
GGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGGTGGGCCACTTCAAGCGCGACTGTCCCGCGGAAA
GACTCCGTAGACGTTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGG
CGCCCTACTGGGGAAGAGCTAAGTCTTCGTGATGGGTGCGCGGGTGGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAG
AGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGACTCCGGGGCGTCGAAGAATTTGGCACGCC
GCCAGACGGTTGCTCGTAACAGCATCAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAAGGTCG
TCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCCATGTGATAGG
GATACTGGGCATGCCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATT
GGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTGATGGTGGCCGCTCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAG
CTGCAGCGGTGATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACCGAGTTCCACTTACGGTCGCCAAGACCATAACTGAAGAGGAAGACGTCGGATA
CGCTTCCTGTGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTAGGTAACACAGTGTCA
CACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGCTGAACACGCTTCCTGTGTGGGTACCATAGTACCACACGAGGCCACGAGTGCCTCGGATGTCG
TAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCC
GATCGACGTCGCTTCAAGCGACTCGGGGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATTTTCGATGGCGAGACCGGTTTA
CCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGTAGCGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCA
AGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACGCCTCCTCTGGCTTGGACGAGAACGTCCTGGTAGACAT
GAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTACGCGGACGTGGTGAACAAA
CACCCACCGACCAAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGATGCAATGGCCTCTCCCGC
GCGAACAGTGCGAGGTGATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAACCCCGCACTCGACGCCGACTTTCTGCGTT
CGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGT
TGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGT
AAGCACTCCGAGCGGCATGCTTTGCTTGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGC
GTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAAGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTTGCGT
GTTGGACGTAATGCGAGCGAACAAGCGCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAACTTCTCGGTTGCTTCGTAAGCAACGTG
GGTGTTTGGGCTGACCCAGACAAGGTCAAGGCCATAGCGGCATGGTCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACC
TTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCAGAAGGATCC
TTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCGGACGAGACGAAGCCGTTCAGCGTCGTCTGCGATGTCTCCGATTACGCC
ATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCC
ATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTT
GAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTGTTCGCGGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAG
CTCAACGTACTTGCAGACGCCCTCTCTCGGCGTCCCGACTATGATTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGT
ATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCGCGGCTCCA
CCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATC
CTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGT
GGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTG
TTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTA
CATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCT
CGGAACCGAGACCCACGGTTCACTGCTGCGTTATGACAAAACGCTGTTCCCCTTTACTGGGAACCCGTCTGCAGATGTCCAACTGCGGACCATCCCCAGG
CAGACAGCCAAAACAGAGCGCGTCAATCAAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTG
TTGAGTTTGCGCTCAACAACGCGGTGCACGCGTACACGGGGTTCACACCGTTTTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGG
AGACACTGACCCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAA
TCCTTTATGGATACCAAGCTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGAAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAG
GAAACTTAACTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCA
CCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGCCAATGACGACGCACCCGACGTTCTATGTCGGA
CGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCTAGCTCCTCGAAGCAAGGGCCGGTCACAGCCGTCGACGAGGT
CGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACTGCTGGGCGAGCCCTATCAAAAGGCGAGCGTAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCA
TACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTAGGAGTGTGCCCCAGGCGGCTCCGGACGTG
GCAACAAAGCCTCGATCCGTCGAATCATGCGAAAGGCCTCGTCTAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCG
CTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCTCAAGGCCAAGTGCAATCTCA
AGCACGAGGACACGTTGATGGAGGCGGTCAACCTCCGGGTCCTGTGTCGGGCCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGT
ACTCGTACTCGTACGAGGGCACCTCCACCCCTACTTGACCGGAATGGAGAAGTCCACTTCCACGTGAAGCGGATCCTCCAGGAGCAACGGTGTCGCGGTA
AGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCATAGGCTGTCGCAAT
CTGGGAACAGAAGCGGCGGCATCTTCATAAATAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAG
CGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGA
CAGCTGCTGGTCTTCATGGAATTCCCATAACTCCGTGGGCGAGTACTTGAGCGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGA
CAGCTCTCAGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGC
GGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCATGTTGTCAACGAACAACTGTTCTTTCTGAACAAGGGCACGTTCGTAGATGCCCTAGAAGTGTGG
CCGCCCACAAGGCCAAGAGGAGCGACGAGAACCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTC
CCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAACTCCTCCTGCTGCTGGTGAGGTCATTCGAGACCTCCGGGGGCTCA
GCGATAGCACCCTCCTCCTCTTCTTCCTCCTTCTTCTCCTCTTCATCCGAGGAATCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGA
GTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCAGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCG
AGGATTCTCTTCCTCACCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCTTGA
TCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAAGCCCGCAGGAGCATCATGAGTGCTCTCGAAC
TCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTTCTACGAACCGAGGGTTCGGACGATGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTG
CGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCT
CTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACG
AAGAGCGCACAGGTTGCTGCTTGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTT
TGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGA
AGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACA
TTGCATTACTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCT
CTCTTTAATTAAAGAGGGGACCTGTGAGCTGCCGTTCACTGAGCGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGT
CACA