Description :
From Genome Similarity Track
Location :
Scaffold_687:6944- 8087
Sequence
1143 bases(100 bases per row)
TGACTTGGATTTTGTTGGGGTCGCATGCTGCAGAGACCACAAGAACATGCTGGCTACGGTGACGCGCCGTCTGCCGTCGTGGTCTCCGAACGACACTGGG
TACAGCCACTTGCTGGGCATGCAAGCGTACGGAATGCAAGCTGCGGGACGACTGGATGCTGCGGAAGCTCTGGCGGAGAAGACGCTGTCAATGAACGGCA
ATGATCGTTGGGCATGTAAGGTGCTGTGGTGTTAGCCTAAGTTCACTAGAATTGTGCTGATACTTTCTTTACCTTTACTTTTTATAGTGCACACTATGCT
GCACGTCCTGGAAGCGCGCGGTAATGCCAACCATGGAGCAAGCTACGCGAACCAGTTTAAGGCGGGTTTTGACAATGGCGGTCCGCTGGAGCGCCATTTG
TACTTCCAGTGGGCGCTGTACATGCTGGATCTTGGTCACTACGATCGCATCGACAAGATGCTGGAAGTCAACATTATCCCGTACCAACCGGACGGCGCTC
CTCATGCGGTGCCTACACTCTGCGATGCTACTCAACTGTATTGGAGAATGCGCTTTGCCGGCCATGACACAGCGGAGTTGGGCGAGCAACTTTTCCAGAA
TTGGTCTGCCATCTCACCGTCCCCGAGTGAAAATGACACCGTGAAAGCACGTCTTCACCCTCTCGCAAGAGTGCTCCAATACGTACGTACTCCAAACTAT
GGGTGTTGGATATAGGTTTTGATCTAAGAATTACCTCTTGTTTGAGCAGAGCATTTTGTCAGGCGTTCCTTCTGGGGCCACTCCTCCAGTTGAACCGCTT
GATGCGGAGCCTGCTGTCGATACTGCCCGCTTGGAGGCTCAGCTGGGCCTTACCCCGTTCCAGTTCAGCTACCCTGCTTTTCCTGGTCCGTTGCCGGACA
TAGTTGAATTTGCTGAGCAATGCTAATTATCACTCTTCTGGCTATGGTATACAGGTGAATTGGAAGAGGTATACCAAAGCGTGTGCCGAGGATTTCAAGC
CTACTCAGAGGTATCGTATATGCCGCCCGCGTTCTCTCTGCTGGCAACGATAGGAATTTATCATGTGGTGACGAATTTGTTTTGCAAATATGTAGGCGCG
TTTCAAAGATGCAACTCAAGCGCTGCTGCCGGTGCGAGGAAAG