Description :
From Genome Similarity Track
Location :
Scaffold_43:69423- 72068
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.67Di-N-acetylchitobiase
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.51CG17669-PA

Sequence
2645 bases(100 bases per row)
GGCCTCGAGCGCCTGCCACATGTGACGCGCACCCTCGGCATCTTGCGCATAACCGGCGGTGTCGGCGTTCCACATGCCAACACCACGCAGACCGAGCTGC
TGCACGAGTGCGTACTTGAGCGTGAGGCTCTGCTCGTCATCGTACCAGAGCTGCGTCCACGCGGCGCCGTCGCGGTACGTCAGGAACGGCGATTGCGTCA
TGGCATCCCAATGACGCGCACGACCATTCAGCAGCGCACGCACGTCGCCGTAGTCAATTTGAGAGCCTGCAGCGTCGCTGCATGGGGCGCCGAAGAAGGG
CTCGGCGCGGATACCGCAGATCGCGTTGTCTGAGCTGAAGCTCTCGCACGAGTACTTGTATCCGTACCATGGCACACCAAGCACGAGTTTTGCGGgCTCG
ATGCCGAAGGCGTAGATAAACTCTTCAAGGCCTTGCTTCACAAGCGCGAGTGGCGAGTTCGCGCTCGCAACGCACTGGTAGTAGATCTGGCTGCGCATGT
CGTACTGGAGCATTgCAGTGTTAGTTGGCTTGGTATTCATGCATGAGAGAAACTTCATAGATCCACCACCCACCGACATCACAAACAGGAAATCAACGAC
GTCAGCCAGCTCCTTCCACTGGTAGAATCTCCCATCGATGCCGCGCGGTGCCCATGGCACATCGAAAGTGATCTGTGAAACAAaGCTCGCTACGTTTGAT
GTCCTCACGCACGACAGGAGTTtCAATCATCGCTCGTACCTGAGCTTTGCTCGTGAGCGGATGCCGTTGTAGTTCTTCACGCAGCTCGCGCACCAAGAGC
GTCTGACATGCCGCCTGCTCTCCGTGCATCGGTTTCTCTGTGTCAATATTGACTCCGTCGGCATAGTTGTTCACGATGGCCTCGTACGTTTCCTATCGTA
GTTTCACATCAGGTACCTCCGTTTTGCCTCATGTCCTGCTTTCGTACTCACACGAATCCACTGGCGTCGTGCTGCCGGGTCACATAGCTTTTCCGGTTCT
TCAAAGTTGTGCTTCACGACCACCTTGACGCCTCTGGAGTGTGCGTGGCACAGCAGTTCCTTGTCGACGTTCCATGCGATCGTCGTCACTTTTTCCCAGT
CGTACTGCTTCCACCGATCATCAGTCGCGACGGAGAATGCAAAAACTTCTTTCTTCGCTGGACTCTGCTTCGCATTCCCAACTGGCAGACACAGATCTCT
TGACGCGCACGGGCACTCGCGCAGTCGCTGCATCTCCCACGCCTCCAGACCACGCAGTGGAAACGTCCCTTCCTCATAAACCAACGCCTCTGCCCCTCTC
CACGGCGTTCCCAGTCCCAGCAGCCCcACCACCGCCAGCCATAATGACACTCGTGGCATCATTCTCCTCATTTTGACCAGCATGATCTTCAAGATTAGAG
CGCTCTATAGAGGTGTCCCAGTGTGCATGAGACCAATCAGCACAATTTtGGCCAATCACATCTCGTGTCTCTTCAGGATCGAGGCTTGAaGAGCCGTCGA
TGGGCATGGGCATTGAGATTGAGACCATCCCATCGCCaTGGCGCGCGCGACGAACGGCGTGATGATGGCGCTCGGCaCTGTCAGTATGTGGGGCTTCTCA
CCTGCCTTCGaTATCCAGCAGCTCGCGCTCCCTTCGCAAGCgAGTgACGAGCCTCTCCGGgtGCTCTtGGTCGGTCCGGGCGaCGTCCGCCACATGCTGC
AGACGATCGCGAGCCGCCGTCGCCACGGTGACGGCAAGCGCCCGCTGcACATCTACGTGtACGAACGATCAGTGGAGACGCTcGCGCGTCACcTCTTGTT
GCTACAGATCGCGCAGGACTGGGAGCTGCCGCTTCGCCAGCGCGTCAATACGTTCCTCGAGGTCTTTGGAAACGCTCTTGTGCAGGAGCGGACGAGCGCG
TACATCGAAGCCAAAGCCAAGATGCTGATCGATTTGTTCCATTACGAACGAGGGTGGCTAGCTGACCAGGTCGATCTTGGCCACTTGAAGATGAGGACGC
GGGATGAGGTGGTCGACACATTCCGTAGCTGGTTCCATGGTGTGCAGTTTGATAGTGAGTGACTTGGAGTTGAGATAGCGAGGTGGGAGATTCTAATGAC
TAATGCGTACCAGTGGCTCAGCTTCGCGACCACCGCTTGCGTCATTACTACGAAGTACGATACGACTACCGCAACAACCTCATCGATTGGGACTACACGA
TGAACTTGAAGAAAGTCGAGAACGCCAGCGTGATCCATATCAAACAGTTCCGTGAGTGGCGCAATACGGGTATCGCGTTTGAGTTTGGGGACCAGTCGTA
CACAGAGCCGAATCGATCAATGGCGGCGTACACGGAAGCACGGAAGAAGAACCACGGCGCCGTGCTCTGTCGTGGTGTGTGGACaGATGTCGTCATCGGT
CCTTACGTGTCGTTTGGCGTCAAGTGCGacACCTCCCACAAGTTGGCCAGGCAGCTCTTTGATATCCACAACAAaGGCACCGGAgTGGAGCAAAACCGAC
ACGTAAGAGCACCGTAGGAGACCCGGCGAGAGcTGATGGGGCTGACGTTTGCGCCTTGTGATGGAGCAGAACACGACCGAGGTGGCAGTGTACAATGCGC
TATCGTTTATGTATGAGATGGAGACCGGGAAGATTTACACAATGA