Description :
From Genome Similarity Track
Location :
Scaffold_76:69416- 74410
Transcript NameFunction/comments
Phypl_g2530conserved hypothetical protein
Phypl_g2531conserved hypothetical protein
Phypl_g2532conserved hypothetical protein
Phypl_g2533hypothetical protein PHYSODRAFT_468531

Sequence
4994 bases(100 bases per row)
GATTGGATGCCAATTCGCAACTAAGCGCGAAGGCGGACTGGGCATgacggcgccgtccttctacgaggtgctgggcgtggcggcgacctgcagcgccgag
gacgTCCGCCGCGCGTACCATCAGGCGGCGCGCAAATACCACCCGGACAAGCGCTCGAATGACGTGAACTCGGCCGGTGCcaacagcgaggacgagcagc
aatTCCTGCGCGTGCAGGAGGCATACGAGACGTTACGCAGGGCGGAACTGAGGCAGCAGtacgacgccaagctgcggcaggacgagctggtgcgtAAGAG
GGAGCAGGAGGTAGTGGTCGTGTCCGATGAGGTCCCACTGGGCGACATGCAGCGAGAGATCCTGCCAGGCGAgggggacgacgacgacgacgaggtggtc
tTCACCCACCAGTGCCGCTGCGGAGACCTGTACGAgctcacggaggaggagctgcaggacggcgtcgacgtggtgccgtGCACCGGCTGCTCGCTGCATA
TCcgagtgctgctggacaaaCTCCCGGTAACAGGTGCTCTAGAAGTAACCAAGCTATCCGGATAGACGTCACCACCAAAGGGGAAATATAAAACTTTCAT
TTGCATACATCTCCGGTCTCTCGATGCAATGCTCTGCTCTTTCTGCGTAAGCCACAGCCGGCGGCTTAGAACTCCTTGCCGCGCGGAGCCCCGTGTGACG
GGTATCGCTGCGGCGTCTGGATTTGGTGTAGCACACCCAGGCCGATGTACGCCAAAAAAATGAACAGGAGGCCGAAGAGGAGACCCGCCATGATGTCGGG
AGTGATACTCACGGAGTGCGAGAAGCAGAAAGCCTTGCCCGCCGCGCTGTATCCGACGAGGTAACCCGCTTCACACAAAATGGCAGTCtcggtggtggcg
tccgTATTTTTGGCCTTGACTTGAGCAGCAAGGCGACGAGCAAACGGGTCCTGGATCTCCAACGAGTTGGCGTCGTTGCCAGTAAAGGCAAAGTCCGTCT
TCCCACCCGTAGCCGCATCGAGGCTGCTTGAGGCTGCCTGGATggcagcgtccacgtcggGCAGCGACATCGACTCGggaagctgcacgaccagcaggTC
GGCCTTGCCGTTGGAAAACAGCGTTTTCCCCTCCGTGGATGCAATGAACACATCCAAGTCCTGAACCCCGACGATATGAGGCTGAGCGTTCGTCAGCTCG
GGAAGCAGCGGCTTCGTACGAGTAGTTTGCGGAATTACCACTGACGACACAGAGCTCTGTACGGCACTCTGCACGAAGGATCCGGCCCCGCTAGAAAGCT
GGAACACGTCCTCTgaggccagcgacggcaggaGGAACACGCACATCAGCTCCGCGTGCTGGGTTGAAGACGCCTGGGTGCTCAGCACGCCCTGCCATGG
TCATAAGAGCTCGTTATCGGTCGAATCACGGCAACCATGACTAAAGACCGGTCGCACCTCCTTATCAGCGCTGGCAtcgcgcaccagcacgcgtTCGACG
GCCGACGCTACAGCAgcctcgtccatctcggAGCTTAGGTAGGCGTTGGGTCCaacgaagatgctgcagggcACCAACACACAAAAAAAAACCCTGTAAG
ATTCCCATACTTCTAAAACTAACCATATACACAAGGAGCGAGGTAAGCAGAACGCACGGGCGCCGGGACCACATGACCAGCGGTACATGGGGGAACAGAG
TGGAGGCCTGTACGGTCGACATCGCAGCCGCCAGGCCGCAcagcgcggcgcccagcagcgtcttcatcatTGTTCtagcgtctgctgctgcttctccgcc
GCTTTGGATCCTGTGTCCGTTTCTGTTTTTTTAGAGTTCACACCGAACGGCTTACTGTTTGGTGGTGTGTACACTCTAACCGCCACCGAGTGACTAGCAC
CACCCAACTATTGCCCGGGCCGACCCGTTGTGCTGCGGGTTTGAACCGTTTTTCGCCGATTCGTGGCTCACTCGCAGAAGAAACTCGCAGGTACGACTAC
CAGATCCCGTGGGCCGCAgtggagctcctggacgcGCCGTTTGGCCCGGCACCGTGACCCCCTCCCCCCTCCCCGTTCCTGTGCTCGCCGTGCTGACTGC
CGCTTCCCCGTTGCTGTGTACGCAGTCTATCACCGTCTTTTACCCCCAGAGACCAAGCAACATGTCGTCTATCCTCGCCTCGCTCGACATGAGTCTGGAC
GACCTGATCGCCcgcaagaagaccaagcccACGAACCCGGACTCGCGCCcggccaaggccaacaaggagaaggacgcaGCCGGCCCCGTCCGCAACGAAC
GCCGTCGCAACCGCAGCCGCAACCAGCCCTACTCTCGATCCGTAAGTGCGCCCGCGACCTGAAGGGCTCGATCTATTTCCCCCTCTCTGTCTCTCCTCCA
CAGCGGAAGGCGAACCCTCGCTCGCTACCTCTGTGACGGGTACACAGACAGCTGAGATTCGCTGTCTTCCCTCGCGGGGGAGCATTGGCTTCTGCCTGCC
GATTTGCTGTGAGGACGGACGTTACGTTGGAGCGGAAATTCACACATACATTGtctgctgcatcttctcCCTTGGTGTCCCAAAGcgcggcggcaacgac
gatGACATGGACATCGACCTGGACGATGCCCCGGACAGCGGCAACAACcgcggcagcaagaagcgctcCGTGGTCGTGAAAAGGCCCgccaagggcggca
agaagggTGCGATTCGGACTTTGCtatttgttgttgttgctgagGTTCGAGGCTGTACAGACGCATGGTTGACGATTCTACTGAACTGTAGGCGGTTCGT
CCATCCTGTCGCGTCTCGGCGGCAAGGATGCGGCCAGCCCCGGCACCAAGATCCTGGTGAAGAACCTCAAGTTCGACATCCTGGAGGAAGAGGTGCGCGA
GCTCTTCGGCACGGTGGGAGAAGTGTCCAAAGCTGAGATCGTTTACGACCGGTCGGGTCGCTCAAAGGGCATCGCTCGCGTGTGGTTCACCCGCCGCTCC
GACGCAGACAAGGCCATCAAGCAATACGACGGTAGATAGCATTTGAGGATGGGTTACTGTTTGCCTCAACACTAACGCTCTTGCGGCTTGTGCGTCTGTA
TAAACGCGGTAGGACGTACGCTGGACGGACAGCCGATGCAGATTGCGCTGGACGCTGACAAGAACGTTCGTAACGGTCTTTTTGGCACGGCACTTGACCG
TGACGACAAGGATGTTAAGTTCAAGGTCTCTTTCGGGTAAGTCAATCGGCTTAATCCCTTGTTTCATGAAGTTTACACGGCCATGAAATCTGACGTGTGT
ACTTTAACTTAACCCCCAACAGAGGAAAAAATGACAACGAGCAGTCCAAGGGCCGTGGCAACagacgccgtggacgcggcAATGAAAGAGGCAACCAGGG
GTACGTCGCAACACTTCTGCTGCTACTAGAACGTATTTCTAAACGTATGTATGTCGTACTACAGTGGGCGTGGCAAGGAGCCTGCGCCGTCCAAGACAGC
CGAGGATCTGGACAACGAAATGGACACGTACATGAAGGACGCATAAAGATGAAGGCGTGGTGCATCCTGCAGATCGGATCTTGATGCTCGTCTCCGGCTG
AAGCAAGTTCAAGGCTGTTCTACCCTGGTGACTATGCATAGTTGTTTTGCATTTTAACGGGTGCGCGTGGCGAGTGGGTGTTTGTATTCGCTACCTTTCG
ACAGAGCGCTTGAAGTGCCGCCGACACGTGAGAGAACGGGCGGATGAATGACTTCTTCGCGACACGTGCCCCCATTTGAATAAAGCATCTCCATGAGCCT
GAAAAATACGGACCCCGACCAAGGTCTGAGCGGCACACCGCCACCGCGAGCCAGGATGAAGTTTGTGCGTTGGCGCTCCAGTTACGTCAATTATTCCGGC
TTGGACAACCATCAAGACTACCGGAGCTCGTGTGGCGAGTATGCATACTCCAACGCGAACGTGCGAGATGTCCACCAGGTCTGAGGTTTAGCATAGTGTC
AGTGAGGAGACAGGTCTGCCATGCCATGATTGGCACCGCTACTTTGCTTTATTACAACTACTACTACAGTGTACAGTAATAGAACACCACAGTTCACGAA
CTTGTAGGAaggcgttgttgttgttggtagCATGGGGCTGTATCCGCCGCATAGAGTGTGGAGTTCATTGTCAGAATCGCCTGATTGGCCACGGAGCGGA
TCCCCTAACGATGGACACACTGGGGATtgagacggaggaggagttGCACGGTTGGCTGGTCAGGGGCGTCTTCGCGCTAGGCGTGGTGACGTAtgtggcg
acggcgctcaTTACTGCTCCTTACGGCCGTCACGTTCGATCAGGGTGGGGTCCAACGGTGAACACACGACTCGGTTGGGTCCTGATGGAGACCCCGTCGG
CTGTTTGGTTTGCAGTGGTGTACTTGTGGGGAGATCACCGCCTCGAGACGACCCCCCTCATCGCGGCGAGTCTGTGGGGATGCCACTACGTTTACCGACC
CTACGTCTATCCGTTCCAAATCCGTACAAGCAAGGATAAACGCATGCCGCTTATCGTGGTGCTCTCGGGGGACTTCTACAACATGATCAACGCCTACATT
AACGCTCGGTACCTGAGCCAGTTTGGCGACTACAGCGGGGACGACCCATTCGCACGTCTGTCGTTTTATACTGGGgtcgcgctcttcgtgtTCGGTCTGT
TGATGAACGTTCACTCGGACCAAGTGCTGATCCACCTCCGCAGACCCGGGGAGAGCGGCTACAAGATCCCCCACGGTGGCCTGTTCGAGTACGTGTCGTC
GCCCAACTACTTGAGTGAATTGCTGGAGTGGACGGgctggacgctgctgtcTCAATCGCCTGCGGGTCTTTCGTTTGCGGTCTACACCGCCACAAACCTC
GTGCCCCGCGCCCTGAGCAACCACCGCTGGTACCAAGACAAGTTCCGCGAGGAGTACCCGGCCAACCGCAAAGCCATCCTCCCGTTCCTGTGGT