Description :
From Genome Similarity Track
Location :
Scaffold_1156:6940- 9040
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_1156-abinit-gene-0.8P-type ATPase (P-ATPase) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_1156-snap-gene-0.5Conserved gene of unknown function

Sequence
2100 bases(100 bases per row)
CGACGCATGAACTTTCCTTCAACGTATCATATCTTGCAAGAGCGTGAAATGCTGAGCATGACGAACTCGCCACGAAGTATGCGCAACGAGTACAAAGGAC
TGATGTGGCCCGACGTGCAGGTACCAATCCTCGATTATGCGAAGATGTTGCGGCAGATTCCTCCCTTTGAGAGCGCGCAGGAATCGTTTATACGATCGTC
ACCTTTGGCTGAAAGTTTGATCTCAACAAATGGCGGTGGGGGCACTGACACGGAAGCGAGGCATATACGATCCCGTGCTTCCTTTCATGTGTCTGGCAGC
TATGACGACGATGAGTATGGTTTCTGGGAAGAGGGGCATGGGTTACATCATCACCATTCGTTTGATGAGACACACATGGCGTCGCCTGCGAAAGTCCTCG
ACGCTGAGGCGCAACGAAGTCAGTACCACGGGTATGCGTTCTCGGAAGACGAGAACGTCGACAGTGATGTCGAAGCCGCGTCTGTGTCGGACAAATACAG
CAAAATTCCCCCTGGTGGGCTATCCAGTAGTGTTGCATCCTCTGCGTCTTCTGTAGGCCAGGCAAGTAGCACTGGGACAGCAAGTGCAGGCGGACGAACT
CTCAAAAAGATGCTCAAGAGTGTACGTGGACCCAAAAATGCCTAATTTGCAGTAAAACAACGTATGTCGACAGCCTATAGGTCCATAGTATGAAGCTAGC
AGCATCTTGAAAATAAGAATGTGTTGCTACTATTCGTGCGCCCATCGTTTGGAAGATCTACAGCTGTCTGCACAAGACAGTCTCGTGTTGTTGTCGACGC
TGATGTCACATCCTCGCCTGCAGTCGTTCTCCATTTAGTACTCGGCGACGCGGTGCACTCCATGCTCACGTGGAGATATTTCCGCTCGCTGTAGTTTGGT
CGCGCCGTCACAATGGATCCGATGGTGTGCGTGGCGCATACGTATGGCCGCGCGACTCGCTCGGGCTGAAAGTGGTCAGCTATTATGGGTCGATACGGCC
GAGGTACGACAACGCGCTCGACTTCAACGCTCTTTTCTAATGCTGGTGGCGGTAAATGTGGTGGTCTAATGAGCACGAGGATGTTACGGAGTGTTGATTT
CTGTATAGAACAGCATGAGTGAATGAGTATGAGAAAGCGCATGAGAGAAAGGAATAATGTAGTTTTGTATATTACCGCCTCCCATCGATCATCGCCATCC
TCGTATTCAATGTGAACGCCTCGTATGTTGTCTGTAGCGGTGATCTTTCCCGCAAACCAGGACGCCGACTCTGGCCAGTACACCAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACCAACTGAACATCATCGCGATCAGGAAGTAGCTGGAGCTGCTGGCATTGCGAGACATCAAAGCCAAACATCGCGGGGCTGTATCG
AAGATAAGTCCCCGTCTAAGATAATACAAAACGAAACGGAGGCATCATGAGCATGCAGCAGCGGTACACAACTATTAATCGAGCAGCACCGCTCCAAAGT
ACCTCCCACGCCTCGTCACCATCCTCGTACTGGACAAAGTACTGCTCCGTGCGTGTATCCACGTCAGTCACTTTCCCGGAGAACCACTCGCTTGCATCGT
GCCAGTAAACCTGCACGTGATCGCCGATCTGCCATGGCTGAGTTGCCATCTTGGAATCATACGATGCGCTGCGAGCAGATTCCAACGATAACGAGACCCC
GACGGATATCTTGGAGCTCTCATGGCCAAACCGCACATTGCCACCGTCATTGTGCATCTGTTCCTGCTCGTCGTCTTCGTCGCTCGACTCGAAGGAGTCG
GAGTAATCGTTCGATGCCTCGTCGTCTTCCTCGTCGATGGACTCCATAAACGCATCACTATCATGGCTCGCCATTGCGTGCCCTTTGCGTATTATTGCCT
TGCTGCGACGGGCGTCGTTTTCCGGCACTGGGAGCTGAGTGTGCGCGCGTATAAATAAAGATAACAAACTGTCTCATATAGCTGGCTGGCTGGCTTTGAG
CAACAACAAGAGCGCTGACACAATGATGCGGACATGCCGCTTCTAGCTGCTTTATATTTCCCACTTGGGCATGCATTACGCGAATAGTGGGGATGCTTTT