Description :
From Genome Similarity Track
Location :
Scaffold_1243:694- 3588
Transcript NameFunction/comments
Phypl_g12869hypothetical protein

Sequence
2894 bases(100 bases per row)
CCAAACGGGGTCGTCGTCTCATTACGAGTCTGCCACCGAAGAAGTGGATACCGACAGCGTGGATGGCCAGCCGCGAATGCCATTGTGACCATCTGGTGCT
GCAATGTTGCAAGATCGCGTCGGACGGGAGGCTAAAACCTCAACTCGTGATACCAAGATCACAGCTGTAAGTCCAACACGTCACTCGCCGGAAAACCTGG
AGTCATACTTCCAGGCTGCGATGGGACGTTTTCTGAAGGAGCAGCGAACGACCAATACGGTGCCTGATGTGACCCCGATTGGTGCAGTGGACGTAGAAAT
GGTGTCGGACGGGTCACCGGACCACCGCTGTTCGCCATGGGAATACGACCCAGACGATTTTGATCTCACCACTCCAGCTCGTGTAGTTGTCGCTACAACG
TCGACTCCAGGCACGGGTAGATCGACAATGGCTCCACAAATTCGCGTGTCCGCAATGTCCGAGTTGAAAGAGTTTGCTGGGAAAGATGGTGATGAAGATC
GAGCTCGATCTTGGGTCGGGAAGGTGAAGTCTGCGTTTGTTCGCGACGAAGCACCTGACGACGAGAAGTGTTTGGTGTTTGGAGACCTCTTAACGGGACC
TACTCGGAACTGGTACCGTCAGTTGAGTCGCACGACACGCAGCTCTTGGAAAGATATACATCAGAGGTTTCTGAGGCAGTGCTGTGACCGGGGCGTTTCT
GTCGCCCGACAGTATTATCATGCCCGGAAACGATCTGACGAGACGCGACTAGAATACCCCCACCGCCTCAACGTGGCTGGTCTGCGTGCACGTCTCCAAG
TGAAGGATGGGTCAGCTGAAGTCCGCCGCGAACATGTCGAGCATTTTATCGAGACACTTGACGATCGCGATCTTGCCGACAGCCTGGCACTTCTGCGTTA
GAAGAAACGCTGCGCTCCCGTCAATGCTCGAAGGCGCGTCAAAAGAAGATGGTTTATCGATCGGTTAAGCCTCGCCAGAAGCCACCAGTCCCTGCTGCAC
CTTCTGCGTCTACTCGAGCGGTCCATGGGGTTCAATCGgccgacgacagcagtgAGTCGGAAGAAGAGTCTAGTGGGTCCGATGGCGAAGCAAACCACCA
TAGGGTGTCCATGTCGTCAAGCGGAAACCACGAAGAACCCCAAGATCGAAGGTCAAAGTCGCCCAACCTGGGGACGTCGCCGAAGCGCTGTTAGCATGCG
GTTCTAGCAAACATAATGACCTTGATTGCTGGGGACGTTTGACCTGCGATAAGTGTGGGCGGAAGGGACATCCGTCGGACCGATGCCTCTTCGTGTGCAA
GACCTGTGGAGAAATTCATGAGGCCGAACTTTGTCCGATAGAAGAGTTCTACAACCTGATCCGTCAGTGGTTCAATCCCACCAAGCATGGAGGTATGTTG
CCCCAAGCGGCGGAGAAGATGTTAAACTAGGACGCTCGCCAGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGCTTCTGCATCTATGCATATATCGAGAA
GCAGTCAGAGACTTTGGTTAACAAGCTGATGACACCGACCCACAATACATGTGATCTTCAAAGAAAAGCTGTGGTTGCTGTGGCAAGTCTTCATGAGGTC
GACGAATACTCAAGATCGAATGTGATGATGGCCCTGAACATTTCGCCTGGGGAATTGCGTGGTTACTGGATCTTCCACGTACCAGACAAGGAGTTCAAGC
AAGCGAAAGCTATGGGGAAGATCAACAACGAAAAAACGACCATGTTGTTTGACAGTGGCGCCGAGGTGTCCATCTTGGACACCGCCTTTGCTCGTAAGGT
TGGCTGCTACATTGACGAAAGTCAGACACTGGTATGCGAAGGTGTGCGGAACGCACTGTACGCGACAGAAGGTCGTACAAGGCTCAAGATCACGCTTGCC
GGGAACTTGGTGTACTTTTCGACGCCTGGGTAGGCCCACCAAGTGGAGGCCAAGATCTGATCTTGGGTATGGACTTCATGGTTCCTGCTGGGATACGTCT
CGACCTGGCTGACGGTACGCTGTGCTTGCCCGACGAAGTCCGGGTAAGATGTCTGGCCGCCGTCCACTATACGGTGAACCGGTGGAGCAGGTAACCCTGA
AGGAGGATCGTGAAATCGACGTGAGGTATTCAACGGAAGTGAGATTGCGTATCCAGAAGTCGAGTCAACATAGACTATGGGTAACTCGTGGAGATCGATG
GGTTCCTACCGTAACTGCTGGACCTGGCGACACTCGCTACTTACACCTGACGAACGTGAGTGATCGCAAGTTGACGGTGTATCAGAACAGCCTGGATCGC
AATGTGACTGTCAGGAGAGCGTGTGTCGCGACTACCTGGATGTGTCTCAGTGGGATCGCGCAGATATGACGAGTGGCAGAACCTCGCTTACCGTGCTACG
ACCTAcaaggaagacgacgcgTCGGTAGACGAAGTGCTGACAGGCCCCGCTGTTGAGCGACCACACTATGTGACACCGAATGCGATCTTGTCCCGACTGC
CGAACCCACGCGACGTTCGGGtgtgcagcgacagcggagaCAGCAGGGACGAGGCCAAACCAGACGAGATCAGTCCAGCATACGACCTAGGTGCGGAGTG
TGTGTGCGATTCACATACGTCGCCGCCCAGGGCGTACGTTTGCGTGGCCTCGGAAACCGCgatcgacgacgaagacgctgctggaagacgcgAAAAGTCA
TCAATCCGCGACCACAAGACCGACACTGACCGAAACAAAGTTGACCTCGATCTTGCACGTGATCTCGATCTGGCAGGGGACGAACAAGTCTGCTTCAAGG
AGAGTGGTGAACTGTTCGCTGAAGATCTCGCGAGCCAGATGACGGCATTGCCGGAGGTCGCAGAGACGACGGAAGAAGTCAAGAGGGAGGATAT