Description :
From Genome Similarity Track
Location :
Scaffold_790:694- 3129
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_790-snap-gene-0.5CREG
Pytar_ATCC12531maker-par_contig_790-fgenesh-gene-0.2Phosphatidylserine synthase

Sequence
2435 bases(100 bases per row)
GACGATGGCCCACACGATGACCATGAAGACGGCGACGCTGCTGCTGGTCGCTCTGCTGTGCAGCGTTCTGACGGCGGTGGACGCGCGTCTCGTGCTGCCG
ACTCTGCGCTACTGGACGAAGCCGTCCGCCGACCAAGCGTTCGTGCGCCCTCGTCGTCGTACCCTAGGTGCTAGACATTGTTTGTGCTGACCTGTCTCCC
CTATTGCTTTCTTGTTGGCAGTGTGTACCACGCGCGCCAGCTCGTTCACCTGAACACGTGGGCGACTCTCTCGACCAACTCGATCGACTTTCCCGGCTCG
CCCGAGGGCCACATCGTCTCGTACAGCGGTGCGTTCGGTCTGGCGTAGGTGTCCTGTTCTCAGCCGCTCACCTTCTTGTGCATGGTATTAGATGGCATCG
GCAAGTCGGCCGCGAATTCGACCGGCGAGATCTTCTTTTACCTCACCAAGCTGGACTCGGCCGCCCAGAACCTCGAAAAGGACGCGCGCGCCAGCCTCAC
CATGTCGCTCGCGCAAGAGGGCGAGCACGTGTGCAAGAAGGACGTCATGGATCCGACGTGCTGGAAGATCACGATCTTTGGCCGTGTCGTGCCTGTGACG
GGTGACGCCAAGATTGAGCATGCTGAGGCGGCGCTCTTCTCAAAGTATGCTTGGTTATCTACAATGTAGGAGCAGTGGGATACTGACGTTGGACGCTGTC
GTTCATGGCAGGCACCCTGAGATGGCGACGTGGCCGCGCAACCACGGCTTCAGCGTCTTCGTGCTCCAGATCGACTCGATGGTGCTGCTCGATTTTTACG
GCGGCCCCAAGAAGATCACGCCGGACGACTACTACAAGGTCCACCTCAGCGACGAGTAGCTACAGGAAGAGTCGATGCGGAGACGGAAAGAATGACTCTG
GCTATTCGCTTACTATGTGACTACGGTCCACTGCAGAGTTCTCTATAAGTCTCTCTCTAATACTACTACTAGTAGGCCCACTGCATGGAGAGCGCGAGCA
GCGGCGTGAAGCTGATCCAGAAGAGGACGTCGAGCTTGCCCCACGACGTGACGGCGCTGGGGTCCTGCGTTTTGGTCGGTGATGCAAACAGCGAGCGGCG
CCCCTTGGCCACGGGCGTGCGGGGTCGCGGCTGCGAGAAGAAGATCGCCATCCAAATGGAAAACATGACGAGAAACGCCAGGATGGGGAGGGCGACCTCC
AACGGCGGAGGGCTCGTGAAGATCACGCCGGGCGAGAACTTGACCCACACGAGGACTTCAAAGCACGCGATCGAGAGGATCATCCACGCGTTCTGGCCGA
GCCGCCAGCAGTCGGGGTTCACGAGGAACTCATAGTACTGCCAAGGGATCAGTAGAAGAGGAGATCAGTTCATCTGTCCATCGATCGAGGGATGAGGGGG
AGAGGGAGAGAACGCACCTCGGCGGCGCCCTGGATGCCGATGAGAAACATGAGCGCGAGGCGGTAGCTGTTGAAGTTGCTTTCCTTGGGCACGCTCAGCG
TGTTGAGCAAAAAGAACGCATTGAGCTCAACGACCAGACACACGATGAGCGCAAAGAGAATCTATGCACCACAAACGTGATTAGATTCCGACATATGTCC
CTCACACAGCATCAAAAATCAACATAAAACGTACCGACGCGAAGCGCTTGAAGTTGGAGAAGACTTCCCAGTCATACGAGGCCCAGCTAATGGGCGTGAA
CTGGCTGAGCGCAAAGAGCAAGGCGCCCATCTTCTTCTCTTTCTTGCCCGACCAGTCGTACACTTTGGTCTCAAAATATGTCAGCGTGATGCGCCCGAGC
ACCATGCCCAAGAGGTTGGCGCCCAGCAGATCCATAAAGAGCGAGTCCCACCAGCACTCTTGAAAGTCCGGGATCACGAACTGCAGCGCGAGCTCGAGAA
ACTCGAACGCGACGCTGAGCACCCAGCAGAACCGCCAGTCGCGAAACATGCACATCTTGCCCCACCAGCCCGTGACGTGGGCCACGAACCAAATGCTCGA
GACGCCGCGGTAGAGCGAGTTGGCGTTGATGTCGCAGTCGAGCTTCGCGCCGAGCGGCGTGAGCTTCTTGGCGGTGCCGACTTCGGGGAAGAAAAACTGC
ATGCTCGTGATCGCGCCCGTGCGGCTCTGCACCGACAGCGCCGCGAGCAGCAAGAGGTAGACGACCGAGCAACCGTGGACAATGCGCCAGACGCCCGGGT
GCGGCCGCACCATGAGCGAGTCGCGCGTCTGCAAGAAGCAGTAGACGAGGAAAATGAGCACGCCCGTCGAGAGCCCCGTGCGCACGTTGGTCACGACGTC
GTCCGACTCGTGCGTGAACGAGTAGTAGCTGGTGGCCACGATGACGCACGCGAGCACGACCACTTGGCGCGGCTGCTCGCGGAAGAGCAGCATGTCTTCC
ACGGCTTCGTTGCCCTGCGCCGCGCGGAACGCGTT