Description :
From Genome Similarity Track
Location :
Scaffold_827:6939- 7970
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_827-snap-gene-0.3MtN3

Sequence
1031 bases(100 bases per row)
GTGTCGTGACCTACGCTGTGCTTGGTTCCGCTGGTGTGACACATCAGACCCGCCACCAAGTTGGCGATGTCGTTGGATATGTTACCATCCTCACGGGTAT
CATTGTCTTCTCGTCACCCTTGGaGAAAGTTGGTCCGGTGCTGAAGCATCGATCGGCCGTGTTTCTTCCTATCCACATGGTGTGCGCCGGCACGATCAAC
AACCTCATGTGGACATGCTATGGTGCTCTTACATGGCGATGGATTCTCCTCGTTCCCAACGCGATTTCCCTCGTCTCCGGGTGTTTTCAGCTCGTGCTTT
ATGCCATTTTTtACCCCGCGACACACCCAATCACCAGCCCAGACGCATTAACAGcgTCCGACTCGGATGACAAGTTCGACCTCGAGGCCGGACGACACGA
CACATCAAGCACGGCTATCGACGACACCGATAAAGACGACTTTGTGgAGCTGGAaTCGCCTCGGTCCCCTACGTCAAAGACAGTTGAACTCAAAATGTCT
GTTgtttGAGCGAATACTACTAGTCTAATACTTCGTAGACATTGtgggTGTTGACTACTGTACAGCAAGCGCTGATGAAAAGAGACAGATGAACATCTAC
TGTGTTCCGCATTTAAAtAAATGCATAGTTCCGGCAATCGATAGTTGCGTCGACCGAAGCTACAGCTTCCTCATTGGAGTCTGCTAACGAGCCATTTTCG
ACTGAATGATAGATAAGAAACGTAACCCACAATCCACCATGATTATGTGTCGGTGGCCGAAACACGACGCTTGACTCGGCATTGTTTACACATCGCCAAG
CTtGCACAAATGACTGCATGTAAAGCTATCGTCCaCCCCCCCcACcTACCACGTGCATCAACTGCCGGCTTAGTCATATCCCACGATATCTAAGATAGAA
TGACGGTAACGCGTGAAGGTGTATTACGACAATCAGACGGGTAACCATCAAgTGTTTACAACCTGTCGGGCaaTCGTCTGACTTCAGCCCTCCAGACACC
CATGCGGATTGGCTAACAGCAAACACGGGAG