Description :
From Genome Similarity Track
Location :
Scaffold_624:6938- 10160
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_624-fgenesh-gene-0.1Lysosomal alpha-mannosidase
Pytiw_DAOMBR242034snap_masked-piw_contig_624-abinit-gene-0.15Conserved gene of unknown function

Sequence
3222 bases(100 bases per row)
GGCTGAAGACCTCACGTGGAGTGTCAAGACGGACGACTTCTTCCCATACGCATCGGACAAACATCAATACTGGTCGGGATTTTTCACCAGTCGTCCTGCT
CTGAAGCGGTTTGCGCGAGTCGGCAACACACTCCTACAGCAAGTGCGTCAGCTCAATGCCCTCTACCAGAGTCACCACTCGGCGGAACTGGACAAACTTC
AGCGAGCGGTCGGCTTAGTGCAGCACCACGACGGTCTCTCGGGAACGGAGAAGCAGAGCGTTTCTGACGACTACTCGCTTCGCTTGAACGACGGCGTCCT
CGAAGCTGAGAAGGAGTTCAATGAGATGTTCTTCGTGATCGGCGAGAAGGAGAAGTACGAGTTCTGCTTGCTTGCGAACACTAGTACCTGCGACGTGTCC
ACTTCAAATGAGGTAAGATTCTGTTTTGGTTGAAGTTGGTGTGACTAGTGCGAAAACTAACGCTTGCGTGTACCTTGCCGCTGTAGAGTTTCGAAGTACT
GGTCCACAATTCGCTGGCGCGGAAGAGCGTGCAGACGATCTCGATCCCGATCAAGCACAAGAACTTTGACATCACCGTGATCTCGGGCAATGCGAAGGTG
CGCCAGCACGATGTGTTTGCTGCGATCCCAGTGCACCCGGAGCAGAAAGCGGCCGAGTACTCGCTTGTCTTCAGCACCGAGATGGATCCGTTGAGTGAAA
CTCGCTTTCTGGTGTCGAAGAGGGCAGAGAGTGCTGACATCAAGAAATCGTCTTCGCCGTTGGAGGACGCGAACGAAGAAGCAGTCACGCTCGAGAACGA
CTTGGTGCGCGTCAAGATCGCCAAGGCCACGGGCTCGATCATTTCAATTACGAACAAGATGAGCAACATCGAGTTACCGCTGAACTCCAGCATCTTGTAC
TACCAGGCCTTCCAGGCCGACAACGAGCAGCGCTCGGGAGCGTACATTTTCCGACCGGACTCGAAGATCGTGTATCCAGTCGGGAAAGCAGACGAAGTCC
GTCTTGTTGACCTCGAAGTGAATCCAACCACTGGAAGCGTGTCTCGAGTCGCATTCTACCTTGGCTGTTGGGTGACGTTAGAGTACCGTGTGAATGATGG
CGACGCGTTTGTCGAGATCGAGTGGACTGTTGGAGCGATCCCAATCGACGACAAGAAGGGGAAGGAAGTGATCATCCGCTTCGACTCGCAGAACAACATC
AAGTCTGCGAAGACGCTGTACACGGACTCGAACGGGCTCGAGTTTGTCACGCGCGTGCGAAACCACCGCGACACTTGGAACTTGACGCTTCACGACGACC
AAGAGTTTGTCGCCGCCAACTACTTCCCGATCACCACTGGCGCGTATATCAAGGACGACAAGTACCAACTCAACATTGTCACTGATCGCGCTCAAGGGGC
TGCGAGTCTGGAAGATGGACAACTTGAGGTGATGGTGCACCGCCGTCTGCTCGCTGACGATGGCAAGGGTGTCGGGGAATTCCTGAATGAAACTGAGACG
TTTATCGACAAGGTCACACAGAAGGAGAAGACGCGAGGACTGATCGTTCGTGGGAACTTCTTCATCAACGTCGACCTCGCTACTGAGGGTATGCGCAGTC
TTCGAAGCAAGATGGAGAAGCAGTTCTTCGCACCGCTTGTGGCGTTCCGCAAGCCAGTGCCAGCGGAGAGCGAGGTCGAAGGGAAGGTGCCGTGGCTGTC
GGTCAGCCAGTTCCCTGAGAATGTTGGCCTGACGACACTCCAGGAGCTTAGCAAAGATTGCGTCATGGTACGTCTCAGCCACTTGTACTCGGTGAACGAG
CACGCAACCCTCTCGAAGCCGGTGAAGGTGGACTTTACCAAGTTTTTCGCTGTGAAGAACTCTGCGATCAATGAAGTCACTGAGCTCATCCTGACTGGCG
TGGCGCCACTCAGCAGCCAAGAGCGCAAGCCACATGGCGCGAAGTGGAAGACGACGAGAGACTTTGAAGAGGACACCAGCAAACCTTCGATTGCCCTGAA
GGGCACGGAAGTTGAGCTTCAGGTGATGGAAGTGCGCAGCTTCCGCCTCTGTTTCAAGAAGTCTGCTGTCAAGCAAGTCGCCGCGGAGCTTCAATACGAT
GATGAGGGCGTGATGACAGCTGAAGACATGAGCGACTACTTGCGCAGCGTGAAAGAAGAAGCGTTCCTGAAGATTGCGGGGACGGAGCCTGACCTCTTGG
AGCTGGAAGAAGTCATGGCGTGGCAGTGAATCAACACCATGTGAAGAAGAAGAAGAAGTGTGTGGGATGCAATCCCCCATCTGTATTGTCGATAACAAGG
CAGAGAGTGCGAACATGCACTTGCCAAGTCTGAATGAAAGAAAAAAATTCCCGGTGCGTTCCAACTCGTGTTTTTGTTAATGTCTATGATACTGGCCACA
GATTCTCACAGCATCTGATGCAGCACGAGATACCAGATCGTCACACAGCTCACTAGCGTCGCAGCCATCCCAAGCACTCGCAGTGCAATCGACCAGCGCA
AATGGCGAAGATGGTCTCGCACGGCGCCCGCCAGTGACTCTGGCCTCTGGATCGAGCCGTCTGCGTAGCAGAAGGCGACAAACTCGAGTCGATTCGCGCT
GAAGAAGCGCCACCAGCCCAGTGCGCACGCCTTGATGACCAGTCTCGCGAGGAACCGACTCGCTGACCAGAAGACCACGAGCAGCCACCACGAGGAGACC
GTCAGGTACAGCGTCTTCTCTGCAGCACACGCCTGCGACTGGTGCAGCTCGTGCACCTGGCGTTCATTGGAGACCGGCAGCATTGACGCATCAGATCCTG
GGAAGCATTGATCGAAAGACCCGGCAACGGCGGAGCCATTCAGCTCCTGAACTGCTGCTGGAGGCGTCGAGTCGAAATCGCTGGCTTGGTCGAGATTCGC
ACAGGACTCCGTCGTGCTGACGCCGAGCTCAAGGTTATCTCCAGGCTCTTCTGAGGTGCAGGTGTCGTACATCTGCGTCAGTGCCGCGAGCGTCTCGTGA
TGAATCTGCAGGCGCTCGAATGTCGCCGACTGGTTCGTCCACGCGCGATATGAGGCGTTCGCTAAGCGCCACGACTGGCTCTGGGTGTAGTTTCCAGCAA
ACTCCGCCTGGGTCTCGAGTTCCAGCAGCGGGTTCAACGCCGAACCTCGGATCGGGAGCACAGCACTGAGAAGCGACTGCACGAGCGTCTGGGGCTCGTG
CTCGTGAACCGTGGTCTGTGAG