Description :
From Genome Similarity Track
Location :
Scaffold_319:6938- 9524
Transcript NameFunction/comments
Phypl_g6914hypothetical protein PHYSODRAFT_315622

Sequence
2586 bases(100 bases per row)
gcgaCTGGTCCCTTCGAAGCGGACCCAAGATCCTTCAGCAGACTCTTGTTGCGGAAAGCCACGCGCTTCACGAACTCGGTCTGGGAACTCTTTGGCACCA
GAGTTTTCAGTGCTCCGcccatgcgctgcagcgccacgaacaCTACCGAGTTGGTCAACATTGGATGCGAAGACGGAGGCATGAACGGAGGAACAGCGGC
ACTGACGCGCTCCTCTCCTAGCCGGAGCGCTTCTGCCAGAGCTACCACAACCGTAGCGTTTGCCTCATGCCGAGTCTTCGAGGTGATGAGCATCTGGAAT
GATGCTCGTGCAGCGAatgcagcatcttctccgaGCGCCGGTGCTGTGCCCTTTCCCACTGTAAGCAGGCCGCTCTCCGAGGCGCACCGGTCAATGAGAA
TGTCGGCTCGCGGCGTGACTACGTGAGCCACCACGTGCTCACACACGTCCGTCGTGACAGTTCCAACCACAAACTCCACCACTGCTTTCAGTTTTGGATG
CACCTTGAAAACGGCTTCTGACAGTTTGTCGTTCTCTTCTTGCATTGGCGGGAAGTTTGGAGGGAGCCCTGTCGTAGGTAGCTTAACCCCTAGAGTTGCA
GCATGCGCGACGCGTTCTTGCTTCGCAGCGAAAGAGGAAATGCTCTCAGAACTGTGATCATCTTCGATCACGACCTGCAGCGGTCGGAGTTTACGGATGG
GGGTGACAGGTTGGCCGGCTCCCATCGACCCGGAGCCTATCGAGAGTTTCCTGCGCGGTGTCGGGTGCGCGCGAGTCTGGATAAACCCTCGCAAGTCGTC
CAGTTCACTGACGCAGCTCTGCACAAACACTTGGCTGTACAAGAAAGGCAGGTGGTCTTCTCCTGTGCCGACACCCGATTCCTCGGGCGAAACTTCATCC
TCACGTGCAAGGGCGTCACGAATCTCCGCCGAAGGAAGCAACTCTTTCGACTGGTAGTCGCTGCCGTGCAAGAACCCACCGTCCAGACGCAACACGTGAA
AGATACGTTCGGTCTGCATCGCGATGTAGAGTCCAGTCTCGCCCAGCGAGTTCAAGCGTGGTGAACGAtacaagagctgcagcaagaccacgagctgctt
gaagtaCGTCGTCCCCATCGATAGTCTGTCCAGCGAAAGCATGGAGAGGTAGTCACACAGCCACGGGATGCACTTGGAGATGGACGCGTGCAGGATGCTG
GTCtcaagcagcttcttgacgtcCAGACTGGAATCGCGAGCCACTTCGAGCGTGCTGATGCCTTCACGCTCCACAGCCTTGAACGCCGCGTTTTGCGCTG
AAAGTCCGCGAATCGAAGATGTAACTTGCCATTGTGGCGAGAACCGAAGATACCCGAGGAACTTCGCAACCACCTTGAGTCTCAACACCACTTCTGTGAA
TTCCTTGCGAGCGTCGGTAGACGGGGGAATCGTCTCACGAATCGCGTAGAACTGCCGTTCCAGCTGATGTTTCACCAGCTCGGAGAATTCGTAGCTGTCA
CAACTGTGCAggaagtggaagaagaagagctggtTGTCCGTAAAGTAACTCTTCATGCGGTCGAGCGTCGCCGTGAAGTTCTTCGttgcgtcgtcctcgc
tcgtGGTCGTTCTGACCTCCGGTCGATTTTTACGTAGCGAATTGTTGGTTCCTTTGGCGCTCGCCCTGTTGGTGCCACTGCTCGAGCCGTTAGAACCGCC
ACCGCTGCGTTGCAGGTGCGGTTGTGGTGCTTTGTTCAATGGCTTTTGACTCGAGAAGCGTCgatgcagcttgcgcagccGGTCTGGGTTCTTCACCACG
AGCTTGTCCTCCATGATCTTCAGCACCAGATCTTTGTCACTTTCGCCGAAAGGGTTCGAGCCAACCTGGACCAGCTCTTGAACGAAGAACTTGGCAAACC
ACCACCTATTCTCCGGTGATGCGTCCGCTAGCAACtcccgcgctgctgcaatagccgctgctgccacacCGGCGTTCTCGATACCGACGAGActgtgctg
cttctgctggaactgcCGCAGCAAGCTCAAAAACCCGTCCCGTACCTTCTCGCGGTTTGTGTACAGCAGAGATTCCGCAGGTGTCCGGTAGTGCAGGCGC
GAGTCGGTCTCTTCGTTGAACGGGAGCGCGAAGTCTCGCACGGCGCTTGCTTTCATTTCAACCGGCAGCTGGCAACCGACACGCGCGCTTTCAGCCAcac
ggagctcctcgcgTCGAACAGACTCGCGGTCCAGTCGTACCAGCATGTCCTGGCAGATACCTTCGGCCTCGCGCAAGCTGAGCTTCACGAGTCCAAGCAG
ATCCGCCCCCAAGTGCGCTAACACCGGTTCGATCTCTTGGAACACGATCTCGGCGAAGTCGAGACAATGGGTACGCCAGCAGAACTCGGAGGCCGCCCCA
CACGGCGTTTCCGAGCCATTCTCACCGCAGTCGTGTGATAGCTCCACTTGAGACTCAGCAGAGCTGCAAGACGTGCAATCAGCCCGATAGAGCAAACTGA
tgagcacctgcagctccgcacACGTGTTCGTGACCAACCGCTCCTTGATCAGGAACCCGTAGAGCTTGGCCGCCTGCGTGTTCACC