Description :
From Genome Similarity Track
Location :
Scaffold_4:693799- 696643
Transcript NameFunction/comments
Physo_332374polygalacturonase

Sequence
2844 bases(100 bases per row)
TTAACGTGACGGTGAATCTTCTAGCCGTTCGTGCAATGGGCTCGCGATGCAAAGATCATCCTCACTTTGCTTTTTTCTTCTTCCTGCTCTTTCGATCACG
ATGAAGCTTGTCTCCGCCTTCTTCGCCGTGTCTTTGTTGGTAAGCGCCACGGCCATCGACGCGGGCACCAACGCCCTTACCCAGGTCCAAGTTGACGCCA
GCTCCGCCTACAAGCAAGGTGAAGTCATGCCCGCCGATCAAACGGCAGCAAGTAGCGCTGAAGTCTCCCAAGACTCCCCCACTCAAGGCAACCCAAACCA
ATTCTGGTAACTACGACCCTGCCCAAAAGTCTGGGGGCTCGGACGAATCACAGAAGCAGACTCCGCCTGTCTTCACGGGCAAGTGCACTCTCACTGGAGA
CTACGTCAACAACACATATGTGAGTGCATGCAAAACCATCGTCATCGACTCCCTTCGGGTGCCTACTGGCGTCCAGCTGAATTTGACTCAGTTGCAAGAC
AATGCCAAGATCAAGTTTCAGGGCACGTCCACCTTTGGGCCTAAGGTAAGTTTTGTACACCAACGAGCCAGCCAATTTCCCCAAGTTTTATTTTTTTAAA
CACTTAATGCATTTCTGTGTAACCTTCGAGCACCGGTAATTGCACTGGCGAGCCGTCCAACATTCAGTGCTAATTGTTTCCAAGGAAACCACTGTGACGT
GGTGTGCTCAAAGCAAAACTCCGAAGTACACGGACAAGTTTGGGCCACAAGAAAAGAAAATATAGTTGCTGTTTTTCGCTCTCCATTATCTTAACCCAAT
GAACCCAAAACAGTTAAGTTCTATACCTTAGGTTGGCTCTTGAGCAACTTACGGCAGTTTTCACATAATATATTCGACCCAGAGATAGAAGTTGTTGCTC
GAATGAGAGCTTATAAAGGATACGAAGGTAGTGGGGCCAGAATAGCACATCATTTTCGTAGTTACTGCATAACAAAGTGAAGCAGACCAAACCTTTGTTT
AAGAAAACCAAAAAACAAAGAGCTCCAATGTACATATCGTCGAGTATACTCAACTTATATATATTTGGGCCCGCATTTTATGTTGTGATAAATGCGGGAA
GATCGCGCCTTCAGTTTTGCTTTAGGTGCCGGCGAGATTCGTATTGGGTGGGGATCCACAAACTTGTTTGTGGGTTTCTACAAGGTAGCTATAAAGGCTT
CTAATTAATTACAAACTTCCATCAACGATAACGATATGAGTAAAACAGCTAACCCGTTGACCTTGTCAGGAAGTACAGTAGTATTAATACTCATTCTCCA
TAGCCCAGAGTACGATTTTGGATAAGAAATGCGTCTAACTCGACGAGCACTTTGGTATTAATTACTCGGTCCATATTAGCGAAGTACGACACTTCACTTT
ACCGGTCGGAGACAGATGAAAGAGACTCAGCGTCGGAGTTCATGCCGTGCTGAAGTACCTCTACTAAGCAAACTAAGTCAAACTGGGGGAGATATCGAGG
TCACTTCATACATTCACGTTAGACTCAACTGTTGGCGAGATCAGTCGTCTGCTACAGCGCCGCTTTACTTCTCACTTGTGGCATCTTCCCCTGCCCAGCC
GATTGATCTTGGGGTCCAAGCAGTGCGCAACCTCTAGCATGCACTCGTTGGCGTAGGTGACGTTGTTGGAACCACATACGGGGCTTAAATCGCGTTCGCA
GAGCGTCGGACACTTGTCTTCCGGATAGGGGTCTTGGTAGAAGCTTTCGCGCTCGTGCTTGTGAGCTGGAGCAGTCCCATAAGCACCATGACAACCAACT
TGTTGATATTCATCGCTTCTTCTCGTCGTAATTATACTACATGTATAGAGTTGGAGATGTTGTCGCTTGTGCGCGCTGGGTTCAAAAGAGAAAGTGGGGA
GTCAGCGTGCAGAGCCAAATGAAAAATCACGAGGTGCGTACGAAACGTTGTAACTTACAACGTTTCGTACAACTTGTAAGTAAGGGATGATGGTCGATTG
TCACCTCGTAAGGCACAGCAGAATCACCGGTTGTACACAGTACATGTATACGGATATGCCATCTACATTGGTGGTGATTCACCACCTGGTGAACCATGTA
TCAAGCTCCAGAGCTGATACTTTCTCGTCAAAGCTGCTCAAATCTGAATAAGCAATCCTAAATTATAGAGTTTATACCTAGAGCTGCACGGCTGTAATAA
TACGGAGTAGAAAGAAACAGGTTACAAGCTTACGCACGAGCTATGCTTATAGGCAACCCGGAGCGTTGCTCCGGGAGGGTACACAGGTCGACGAATAGTT
TCATGGACGATGATAACGGATAATAATTGAGTAAATCCCAAAGTTGTTTTGTTTTAATCCTTAAAAGCACTACCAGCCCAACTAACTCTCTAGTTGATTC
TAACGTGGGCATCTACTGCGCCTGCTCGCAGCCGCAGCATCTGCCCGAGAATGCGTAATTGAACAAATAGTTGCGCACATCGAAGTGTATCGATACGGAA
ATGATGTTTCAGCCAAACCTTTGTGAGGCTGGTAACCAGCAAGCCCCGCTCTTCTTTATCGTGGTGGGTTCTCAGGAGCCGAAAGTCACCAATTGAGGTT
GCCTGATCTGATGATCGGTGACATAACACCCTGGTCAGCGTCCAATGACTGCGTTGGCGCCAGCAACGAGAGAGCTATTTCATTCATTTTGCAGGTAAGG
TATACTGTGCTCATTTTTGTACTGTTGTGTGCTAACGATCAGACGAGAGAACTACAGTAGCGGAACGAAGGAGAGACGCATGGTGCGCTGATTTTGACCA
TTAACTTGAGGATGTTAGCTAAGTGACAATAATGATCCTCAATT