Description :
From Genome Similarity Track
Location :
Scaffold_28:6937- 11776
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_28-abinit-gene-0.110SCP-like extracellular protein
Pytap_DAOMBR444maker-pag1_scaffold_28-snap-gene-0.49Glucan 1,3-beta-glucosidase

Sequence
4839 bases(100 bases per row)
CCGCTACAATATAGCGGCTGGTGGGGCAGAATGCGAGCCATTCCAGCTTGTCCgAAaGCAAGAAGCTCAAGTGCTGCAAATACCGAGCCATtGGAAAGGT
CTCCATGTAGAGGCCTGGtGTGACTTGTTGCACCCATTGGGCCGGACATTTCAGGCaTAAGCTGAGCATCTtGCGaGACGACTCGCATGAAGTCTCACTC
TTTCCTTCGTCaGACGAAGGAAAGAGTGAGACGCAATCGTCTCAAGATCCTGAGAAGCCAGCTGGCGACCAGCACAGAGCGTCACGCACAGGCATTCTTC
AATGCCGCAGCTTCCTGTTCGTGACTGGCGCTTCGATGGACACAGCTGGCCACGAGCGTCATggaCCCCAGATCCTAGGCTAGGATTCCTAGCTGAGAGC
CTGAGGtGTACTAAGCTCCCTGCCATGACCGATATCTctCCATCGACCCTTACTTCTCGCAGtcTGCGAGGTGGCACAGCACGTGCAAGCGACGAaTGGT
GATCTCGACCTCGTCTCTCTGGCCACATCAGATCGCCATACGGCAtGTTCGTTGAACGGCTTGCTCGTCAATGCTGCGGTGGTACGATCGGCTGGTAAGC
AATCGTGTCTCATCGGCCGCACCGCCACTGCCACTGTcGTCCCCCGCACGCCAGAGAGCACCGTGAATGCAGCATGGCCAAGTGAATCAACACCACGCTT
CAACAGTCCATTCCATCAACACTAACATGAtACCGCCATCTTTTCTTTGATGACAAatGTCTGTGACACCCACAATGCCACAATCCCCGAACGAGTCCAA
GCCCAACATTGTTGCATGCCCCGCGTGGTGACGCaGAtAGTTCCATTCcaCAAACACGGCGCCATCTCGTGGTCGTGACGAGGAGTCACGGCcACCAaGC
CATTAAGgACGGAGGACATGGGCGTTGCGTATGCGTGCGTTTTCTCGAGTGGTTGTGCATCTGCCAGAGTTTCTTGCGAACAtGGATCTAGTTCTCGCAG
TACCGTAATGGACACGCAAGACGCGGCAAGAGCAGATGGAGCATCTGCACTTGGCCACTATGTGGCTGACTATCATCCCCTGCTCAGCAAGGGTCAAGGA
GCCCGTGGCATGCGTTCGGCGCATGGTGTGATGAATCCAGGGCCACAAGTGCGTGGCTTGTGTGGTAGGTCGCCAGGAATTTCGACGAGACCACAGTGGA
GTGCATCACAGTATGAGCAGTGGGAATCCACCGTGGTCCATTGTGGGAATGGTTAGGATACGCCCCTTGGAGGAGTTGACACGAGAGATCCATCCAATCC
TTGAAGAAGTATAGCTCAAATCGAGCCAAGATGGTTCTCATGGGAGTTGACGCGCGCCTATTAGAGCCGTGGCTCAGTCACGGTGACAGTGGCATATCAT
GCTGCGCATCTGCAGCGCATGATGGAGGAACGTACAGTACACCCATCGTGCATCCACAACGGTCCACTGTACATCCAGAACAGCTCCGCCTTATCCACTA
GACGGCGCGATTCCTGTTCCTCGGGTGCCAGTTCTCGGTTCTGCAGGGtCCgTTTtGTTGGTTCTGAACTCTTGTGAAGTTtCAAAaCCCGCCGTACTCG
TGACATCAGTTCAACGGAACAAGGTTCTGAGAACCCAGCTGATGTGCCTAAAATGccccaaaaaCCCGACCAAGTGGCACCAtCTGTGCGGgCAGTGCCC
CATGACGCTCTCTCGCGCCCACACGCGCTCCATGATACCCGGGAGCAGCTGGTTTGACGGACATATGCACACGaCGCCGCGAGGCAGAGAGCGATCGGAT
GAAACGGAGTTGGACGCGTGCTGTGTCCAGCGACGGCtcccACCCGGAGCACTTGTGACCGACCCACTTCCGGATTTGCTCCTCGCCGAACAGATCCATC
AGAGCATTCTCCTCAGAACACCTTCAGCATCATGTTCGGTCAGCGTGCGTTCTTCTGCTTCTCTGCGGTCGTCATGACCCTCGGCGGCTCCGTCTCGGTC
GATGCGCAGCGTCTtcGTGGCCTTGCTGCCCAGGCCACTGCGGCTGAGTTCCACGCGGCGATGCTCCAGGCTGTTAACTCGGAGCGTGCCAAGGCTGGCG
CCGGTCAGCTCTGCTACAACAAGAAGCTCCAGTCGGCGGCGCAGGGTCATTCCGAGGACCAGGCGAGCCACAACGTGATGCAGCACGAGGGCTCGAACGG
CTCGACGCTCGGTCAGCGAGTCACGGCCCAGGGCTTCAAGTGGAGCGCCGTTGCCGAGAATGTTGCTGCCGGTCAAATCGACGTCGCGGCCGTCATGTCG
TCGTGGATGAACTCGCCAGGCCACCGTGAAAACTTGCTCAACCCACGTTACAAGTTCTTCGGTATGGGCTACGCGTACAACGAGAACGGAGAGTACAAGA
GCTTCTGGACCCAGGACTTTGCCGACAGCACGACCGAGGGCTGTGATGGCGGCGCGAACGAGTCTGGCGAGGCCGAGATGCAGCCGATGGATGCCCCGGA
GACTGATGCTCCAGAGACGGATGCTCCAGAAACCGATGCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTATGAGGACTACAATTCGCCTCACTCACTGCACTCGTGAACTAGAATGAAAAACATCGAATGTATGGAGACGCATCACATAAGGCCCTTCTCACATGA
AGCAGCACTAAACGGATACAACCGAGACTACTCAGTCTGAATAGTCGAGCCTGCTATCAAGCGAGCGATTGATGCTGGCACTGCTCATTGCGTATGATAT
ACATTCGAtGTTtctCATTCTAGTTCACGAGTTCAGTACGAAGGGCTCGGCGGTAGTACTACTATGGTAGGATGCAATCAGTTGCAGGGTGTACAGTCTC
CATACTACAAGGACCAAAGCCAAAGTGTCCTAGAAtcACAATCGACCTGAAaGGAAATGgTGCGGTTTGTCAACAaGgAACATTTCATCCACATAGgTGA
CTACTTATAtGAAACGAGTTACGTAGCTGGTAATGTACTCCTATGAGGCTTTTCCTTAAACGCGATCCATGAGAGGCGCATACTCGGCGCGACGACGTCT
CTGGTGCAGATGGGAGACAACCGCCACAaCAATTGCTGCGCCGACGAAGATGCCACCAAGACCCAGCACACTCGAGGCACTCTCGTGAGTAGCACCCATC
TGGACGTTGGCACCAGCTTCGATGATCGGCAGAGTCGCCTCCTGGATAGTGAGCAAGTGGGCAGCCCCGCcGAAATCGCACGTCGCACCATTCTTACGGT
ACTGGTGCCAGTACTGGTTGAATGCCCAGTCCGCCTGCTCCTCTAGGGTCAGgttcttGTCCATGATCGGACTGCAGTCGATCTCTTCCGCGTTACAAGC
GTACGCCAGACCGTTCTTGAGCTCGAATGGCTTGACACCACGCTTGGCTTGGCACACGAACTCGCCCTTGTCTTCCTTCTCGCACGCGTCGAACACTCCG
TCTTCATCGTCGTAGGAAGAGACATTCTTTGGGAACGCGCCGATGCGAACGAGGTCCAAGAAGCTCCAGCGTGTGGCGAACTCGGTCTTGAAGTTCCAGA
AGTACCATCCGTGACCCACGGCAAAGGCGTTCAGCTTCTTGATCGTCAGGTtACGAAGAATGTGGGCATCCTCCTCTTGGGTCTGCTGACCGAACGACGT
GTTACTGTTCACTGGACACATTCCGAACGATGGTCCGGACATCCCGGTGCCGTAAGGACCCTGAATTGGCTTCGTGATATCTAGTGGCGTGCCTGGGAAG
CCCGTACCAAGGTACGTGCTGTGCACAGGGCACTTACTCAGCTGACATGCGACCTTCGGgAAGCCTGGCAGGTtGTCGTTGAATCCGTTGAGCCACATAG
CGCAgTTGTCGGTCGCCACCGACCACTCGCCGACAATCACAGGCATCAGAGCGTTCTCCATGGTGCCCAAAGTGTACTTCTGCTGGCACGCGTTAGCGTA
GAAGTCTTCCTTCGTGCCGGGgTTCATCCATGCCTGGTAGATGTGCGTGTCGAGCGCAATATCTGGGCAGCCACGCATGAAAGTCGACCAGTATTGCACA
CCAAAaCGGAACGAGTCGTGCAGCACGAACTTCCACTGTGGCGCtAGCGCCTTGACGCGCTTGTAGGACTTCCAGTAGTAGTCCTTGAGCACTTGGATCG
GCGTGAGCTCCCACGGCTCATTCACAGGCTGGAGACCAAGAATCGCAGGGTGGTTTGCGTAGCGTTCGATGATTTTAGTGACGGCCAGCAGCGACTGGTT
CAGGTTTCCATAGTTGATcGACGAGTAGTTGTGGTTCGC