Description :
From Genome Similarity Track
Location :
Scaffold_70:69367- 71203
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17473prefoldin subunit 3
Phypa_INRA-310PPTG_17474hypothetical protein

Sequence
1836 bases(100 bases per row)
GGAGACTCGTCTCCATGAATTTGTACTTGCTGTACATCTGTTGCAGCGCCCCGACGAGCGGCTCGATGTTTTTGACGCCGCATGCATCCATGAAGGTGTC
CACAGAATCCTAAGAGCCAAATATATTAGATTGATGCAGTTTTGAGGGGTTGAAGAGCACGAAACGCACCACGAAGACAGCAGACGGGATACCACGAGGG
TTGCGCTCGCCCATGATGGCGGCGTTCAGACGCGCGAGCGCCTCCGGACTCTCGAGGCCCGTGGACGTGGGGGCTGAGCTGGCCATGGTACGTACACAAC
AATGGCTGGCGGTGTGCGGGGATTGATATACTTTGTGTCCGGAACATTAAACAAGTGTGGTGCACATGCTTTTGAGAGAATCAGGCCTTACTCGCGAATC
GTGAGAGCGTGCAATGCTCTTCAACAACCATTTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATGGAGCACGGCTGCCACGCATGCCTCACTTTGCTT
TTTTTCCCTCTGTTGAAAGAAACAGCTATCGCGCGCCCCAGGTCGCCGATATTATCATAGAGCTCCGGTTGCTACCGCTTTGCAATGCTCCGCTTCGCAT
TGGCCGCGGCTGGGCTCTCAGTCTACTTCGTCGCCGTGCAGGCGTCGGTCTCCGTAACCATCTCTAATAGTTGCTCCGAGTCCGTCGCGCTGTATGACAA
CAGCGCAACCACGACGCTTGCCTCTGGTAGCTCCACCACGCGCACACTGGCAAACGGATACGTGGGCATGTTCCGCAATGGGGTCTCCGATGAAGCTACT
TGTACGCTGTGCCATCCGGGTGAGCCCACCGAATATTAATACTGACTTCTTGCTTCATATTGCAGTGGCCGAAATCTCTGTGGACTCCGACGGTACGCCT
TGGTATGATATCAGTATCATTCCGCCTGACCCTGGTAGCTGCACGAGTTTGAGCGCCTGCCAGGCTCAGACCGGCAAAACGGGTTTCAATACAGCCATGC
AAATCACTCCGCAGGATAATGTCGGTGAGGATACGTGCAAGGTACTGACCTGCGAGGCCGACGGATGTGCGGATGCCTATCAGTACCCGAGCGACGACAC
TAAGACACATACATGCCCGAAAGGCACGAACTTTGAAGTGACGTTCTGCCCCGGTGGCAGTGGCGCTAGCACTAGCAGCACTTCGGCCTCCAGCACCTCA
AGCATACCTACACCCACGCCTACTACAGCTACTCCG