Description :
From Genome Similarity Track
Location :
Scaffold_436:6936- 10649
Sequence
3713 bases(100 bases per row)
GATCTATACGATCGGATACGCATGGCGTATCGAGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCAGGAACGAGCGCGAAGTCCGACTGGA
TCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGGCCACTGATTCTCCACGCGTGGCTGTACC
CAACGATGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGTGAGAAGACCTTTCTGTCGGTCTCTCAG
TCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGCACTCTTCGGCTCCACT
ACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTG
CTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTTGTCGATGGCGTGTTCCGCT
ATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGTTGTTCCCTTTACTGGGAACTCGTCTGCAGAT
GTCCGCTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGTTCGAGGACATGTGTGCGCGGCAGCGCCACGTACGTGGTCGTCGC
AGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCT
CACTCTTCGAGGAGACACTGACTCCTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACA
GGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAA
GGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTTAGCTCTGTCGGCAGCAACAAAC
TGACGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTA
TGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGACCGGTCACAGTCGTCG
ACGAGGGCGTCGGAGCAGGCACCTTAATCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGC
CATACGCCGAGTACGCTAAGTACGCCGGGTACACACCATACGCGTACAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTT
GACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTAGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGA
GGGCACCTCCGCCCCTGCTTGACCGGAATATAGAAGCCCACTTCCACGTGGAGCGGATCCGACAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGT
GAAGTGGAGGGGTTATGCCCAGTCCAAGAAGTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGG
CGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCG
CTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCA
TGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGTGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCAT
ATCCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGA
AGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGC
CACGAGGAGCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGG
TGCCGCCACCGAACCCCCACGCACATGCTGGGCAGCTTGGAAATTCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGAGCTCAACAATAGCACCC
TCCTCTTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTG
AGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGAGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTT
GGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCT
TCGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGGGTGCTCTCGAACTCGGCATCGTCCTCACTGCCCGAGTTGAACT
CATGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGA
TCCGATCGCCTCGGAGGCCACTTGAGTAGCCTTCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCACCTTACCGGCTGCAGCCTTG
GAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTA
ACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTGGTCGGTAAACCGA
ACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACT
CCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAGCCCAA
ACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTG
AGAGTTTGTATAC