Description :
From Genome Similarity Track
Location :
contig_2:693571- 695181
Transcript NameFunction/comments
g729.t1hypothetical protein

Sequence
1610 bases(100 bases per row)
TTGATGGAATTGCAGGTCAAGTCAGCCACGCTGTTAGTTTTCAGCGCAGATGGAACTAGAATTCGGGAAGAGAGAATTGTGCCGATTGAGCTCGTCCAGC
GTGGGGATGTATTAAAGGTTGTTCGTGGTTCGTCAGTTCCGGCAGATGGTGTCATCATGTACGGCGAAGGTCGTATTGATGAGTCGATGTTGACGGGCGA
ATCCAAGACAATCAAGAAAGCCACTGGCGACCGCGTATTGGGGGCAACGGTAAACGTCGATGGTTTGTTTCACATGAAGGTTACTGGTGTGGACAACGAC
ACGGCGTTGAGCCAGATCATTCGTCTTGTTGAAGATGCGCAGACCTCAAAAGCGCCGATCCAAGCTTATGCAGACTACGTTGCCTCCATTTTTGTTCCGA
CGGTGCTGGGGCTGTCGTTCTTGACATTTTCAGCGTGGTACGTTCTGTGCGTGTTTGAGATTTTCCCCGAAAGCTGGATTCCGCACACGGACAGCACGTT
CGTGTTCGCTTTCAACTTTGGCATTGCAACCCTAGTAGTTGCTTGCCCCTGTGCTCTGGGATTAGCTACGCCAACGGCAGTCATGGTCGGAACGGGTGTT
GGTGCAGAGCACGGTGTATTGATCAAGGGTGGAGAGCCCCTCCAGGCTGCACACAACGTCAATACGATTCTTTTCGACAAGACTGGAACGCTAACCGTGG
GCAAGCCTGTGGTGACGGATGTTGTAGTGCTAAGCAAGAAGCTGAGCACTGAAGAGCTGATTATTCTGGCGGGGTCGGCTGAACTCGGCAGTGAGCACCC
GCTGAGTAAGGCAATCATCGAATACGCGAAGTTCATCTCGTCGTCTCTCGAGCAGCCGACAGGTTTCCGAGGCGTTTCTGGAAGAGGCATTGCGTGTATG
GTGGGGGAACGTAAGGTCGTAATCGGCAACAAGGAGTGGATGGCGGATAACGGGTTGAAGCGTTTGACCAGCATTGTGCTGCAGCAGGCCACTTTTACCT
TTCAAAATGCCGGGAAGACGACAATCTACATGGGCGTCGACGATGAGCTCAGCGCTGTATTTGGTGTGGCCGATGCTCCGCGTAAGGAGTCGATCCGTAC
GCTGAAGAAGCTGAAACAGATGGGGTTGGAGGTCTGGATGGTCACCGGTGACAACGCGCGTACCGCGTTCACCATTGCAGATCAACTTGGAATCAGCCGT
CGTAATGTCATGGCTGAGGTGGTTCCGTCTCAAAAGTCCTCAAAGGTCAAGCAACTCCAGAGCACCGGTCGCATCGTTGCCATGGTGGGCGACGGTATCA
ACGACTCGCCTGCCCTTGCACAAGCTGATCTGGGTATCGCTATCGGCGGTGGCACTGAGATCGCTGTGGAGACGGCCGGCATGGTTCTCATGAAGGCGAA
CCTGTTCGACGTCATTACTGCGCTGGACTTGTCTCGGACGATCTTCAACCGCATCCGGCTGAACTACGTGTGGGCACTGGGCTACAACTGTCTGCTGATC
CCTTTAGCCGCAGGTGTGCTCTACCCCTTCGGCTTCAGCATCCCGCCCATGTTCGCTGGCGGCGCCATGGCCATCTCGTCCGTGTCGGTGGTCACGTCTT
CGCTCTTGCT