Description :
From Genome Similarity Track
Location :
Scaffold_479:6935- 13828
Sequence
6893 bases(100 bases per row)
ACAGGGGACCTGTGAACTACCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACCTGGTAG
CACTTGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCA
GTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCTCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGAG
TTCGACGCGTATGAGCAGGGGCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGTCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGA
AGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCCGAACCCGACCGAGCAACT
TCGTGTTGCTTTTGCACTCTCCAGCCTTAGCGGCCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATGCCCTGGATGTTTCACATCCTGGGCTCAG
CTGTTCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTATGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGCAAACAAAAAAAGCCCCGAACTGCAC
GAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGATAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTG
GGCCCCGCACGCACTCCGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGATGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTA
CGCCGGCCTCAGCATGGCCTGAGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCCCCGAACAGCGTGA
CATCCGCTGCTTCAAATGCGGGAAGATGGGCCACTTCAAGCGTGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTTCTCAAGGGT
CGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAATAGGGGTGGGGCGCCCTACTAGGGAAGAACTAAGTCTTCGTGATGGGGGCGC
GGGTGGCGCGCACCACGGGGACTTAGCCCCTGACTGTCTTCGCACTCTCGATTCGGCGAAGAGCAGCGGCGGGTTGCTTGTAGTACGCGAATGTGTACGG
GGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGCAACAGCAACAAGTTGTCCGATG
CTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCTAACGTCCAAGTGGATCTGACTGTCAAGTT
TGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCGTATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATC
GACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGCCAGAGCATTGGTGAGTCATATTCCCACCTCTGTCAGGACACGGGGCGCCCGCA
AGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGTTTGGGGGTCGTCGACGTATAGGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGG
CGCTGGCCAAGTGGGTAACTTAGGTCCACAGGTGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAACAGCGTGCTCAGAGTGGGT
AACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGACGAGGAAGACGTCGGATACGCTTTCTGTGTGGGTAACACGGTACCACACGCGGTCGCCCAGA
CCTTAACTGAAGAGGAAGGCGTTGAACATGCTTCCTGTGTGGATAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACA
CGCTTCCTGTGTGGGTACCACAGTACCCCACGAGGCCACGAGTGCCTCGGATGTCGTAGCAACGACATCCCTAGACATAGGCAGCAAAGCTCCACGTCAC
GGTCGCCGTCGTCAACGACGCCGCCGCCGCTTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCCGGCTC
CTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGT
TGCAGAGATACTGAACCTCGAGGAAATGATGGCTGAGTCTTTCTCGGCCAACCTCAAGGCTGGAGAGACTGCTGAGATGGTGCCCATGAGACCTGAGACC
ACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGA
ACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGAATCGAGGCGTACGGCACGA
GATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGATGTCATTGATGCCTTCTTCGCCGCGAAAGCG
AAGGCAGGCATGGCGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACA
AGCTGAGCAGCGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTT
GGTAGACGGATACTTCCAAATCCTGATGCAAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCG
CAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTTACGCAATTATTCCGCCCTTTGCGTACCTTCGTACAAGACGTACTTCGACGACATATTC
GTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCA
ACATCGACAAGTGCGTTTTCGCGTCACCAGAGGTTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAATGCCAT
AGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTAGGCTTGGCCAACTTCCTTCACAAGTACAGAGCAGGGTACGCGGGTTTCGCT
AAGCCCTTGCCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGTGAGCAAGAGCACCAGGATGATGTTGACAGCATCAAGGCCAGTCTCCAAGAGGCTC
CTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCTTCGGGTGTGCATTGCTGCAGGCCGACACGGCTGG
ACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGATCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATAAAATATGCCCTT
GTGAAGTTTCGTGTTCACCTTCTGGGCTCTCGGCCCTTCGTGATCTACACAGACCACGCATTCTTGAGGCTGGCGACAAACTCGCCTCACCTCTCCCAAC
GGATGGCGAGGTGGCTGTCCTTCTTCGCAGAATACAACTTCCGCATCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCT
GACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGT
TCTTTATGGCAGGAACGAGCGCGAGGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGTATGGTCTCCTCTATTACCG
GGTGGAGCCCAATGAACCTCCACGGGTGGTCGTCCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGTCACT
TGGGCCGCGAAAAGACCTTTCTGTCGGTCTCTCAGTCCATCTGGTGGACCCACATGTACAAGTGAGTCGCCCGGTACGTTAAGACATGTGAGACATGTCA
GCGGGTCAAACTCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCAGCTGGCTGTTGGAAGTCGATGAGTCTTGACTTCAGCTTTGGGCTT
CCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTAAATCTTGCTCGGGTTCCTGTCACTTTACGGGCGAACA
AACCGCACGGTTGTTCATCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAAACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAA
ATGCTGTTTCCTTTACTAGGAACCCGTCTGCAGATGTCCACAGCGGACCATCCACAGACAGACGGCCAGACGGAGCGCGTCAATCGAGTGCTCGAGTACA
CTCTGCGCAGTGTGTGCGCGGCAGCACCATGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCT
CACGCCGTTCTACTTGAATGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAA
GCCCTTTCCTCTCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCG
ATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAGACTTAAGTATATTTAAGGTGGGAGACTTAGTATTGCTAGA
CACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGATGAAGCACCGCTTCTTCGGACCATTTGCAGTCCTGGCCAGACATGGTGCG
TCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTAGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGC
AGACCCACCTTGGCCCAGCTCCTCGAAGCTAAGGCCGGCCATAGATGTCGACGAAGGCGTCGGAGCAGGCACCCAAGCCTCGGTATGAACGGCAAAGCTG
CGGTCAAGACCGTACGCAGGAGGGTCTCTGTACGAACGGACCCCGGAGCCATACGCCGAGTACGTTGAGTACGCCGGGTACGCACCATACGCGTACGACT
GGGAGTGCGCCGAAGGCGGCCCCGGACATGGCAGCAGTGCCTCGATCCGTCGGATCATGCGGAAGGCCTCTTCAACATCGGACGAAGAGGCCCGTCGGTC
CACCCGCAGATGCAGGCTCGCGACATCACGCTCCAACAGGTCCAGGCGGCCCGCAACACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCG
TCGCCAGTCCCAAGGCCAAGTGCAATCTCGAGCACGAGGACGCGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCG
GACGAGAGTGGCTTTTGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGTTGGACCGGAATGGTGAAGTCCACTTCCACGTGGAGC
GGATCCTCCAGGAGCAACGGCGTCGCGGTAAGTGACAGCTCCTCGTGAAGTGGAGGGGTTATGCTCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCT
CCTAATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAATGGGGTACGGACGATG
AATACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTCGCAGCATGCGCTTGCCGATCAAGTGGGCAAGCCTCAC
ACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGGTTTCCGTAACTCCGAGGGTGAGTACTTAAGAGACACCACCCATGCCCAGA
ACATGTCCTCACAAGAACTCCACGTGGGACAGCTCTCGGGCATAACCCACGGGTATCACCAAAGAGGATAAAGACCACCCCGGGTCTCGGGCTTCTTACG
ACAAGTCGTGAAGTCCTTGAGAGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAGCGAACAACTGTTCTTTCTGAACAAGG
GCACGTTCGTAGATGCCCCTAGAAGTTTGGCTGTCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAGGAAGAGGTCATCCCCAGCGCTCTCCTCGGGAG
GACAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTG
GTCGAGGTCATTCGAGACCTCCCGGGGCGCAGCGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTTTTCATCCGAGGAGTCGAA