Description :
From Genome Similarity Track
Location :
scaffold_700:6935- 10880
Transcript NameFunction/comments
g9924.t1hypothetical protein
g9925.t1 hypothetical protein PHYSODRAFT_339130

Sequence
3945 bases(100 bases per row)
CTCGTTCTGGTTCAAGGATCGACTTACGAACATAACCGGCAGGTAAACACCCTCGTGATCCTGCGTCAGCGACGCCGATATAGCCCACTCGCTAGCGTAC
AACACAATCACCGGATCCTTCGCGGGGTCGAAGTGACGGAGCGTCGGCGTCGTCGCGATCTTACTCTTGAGTGCGGTGAACGCAGCTGTAGCTCGGATCC
ACTTGTCATGCCCGTCTTCCGGATCCTCGTTCGCCAGGATCCTATCCTTGGATCTCAACTCCGCGAAGTCCACCTCGCGCAATTCGTACAGCACCGACGC
ATAGATCGCCATGTCTTCAATGAATCTAGCGTAGTAGTCCAGGCTGCCCAAAAACGACTGCATCGCTCGCAATGATCTCAGGAAAGGTAGATCCACCAGG
GCCTGCAGATCTTTCGGGTGTGCCTCCAGGCCTTTGTAAGAGACTCGATGGCCGAGATACTCCACCTTCCGTAGGCCCCAGAAACTCTTCGCCACGCTGA
TAGACAGGTTCCACTTGTCGCGCGCTTCCAGCAGCTGATGCACTCGCTCACACAAGTGATCCCAGGATCCCGCAGTAACCAGGATGTCATCGATATAGGA
TCGGCGCCCCAAGACTGAGGACTGACCACTAACCTCAGGAATCCCTTCGATGAAGAGATCTGCCACGGATCCTGGCTCGGAAGCAGGTGGGATCGGCAAG
AAGCCATAGAGAACATTGTCTAGCAGCCGCTGGTAGATCTGCGGAGCTTTCTTCAGCCCGAAGGGCATGCGGTTCCACTCGAAAAGATCAAACGGAGTGA
TGAAAGCTGAGATCGCTCGCGCGCGGTCCGTCATAGTCACCACTCACCATATCCAAGGAACAGTACCACAAGATCGCGTCGAGATCCTCTAACAAGTCTT
TGATCAACGGCATAGGGTAGATCATCAATCGTGTTAGGCTGTTGACCAACCTGTAATCAATACACAGTCTGATGTCCACGCCATTTTTCTTGATGATCAC
CACGATGGGCGACGCCCACGGTGACGTAGATACTTGGATGATCTTGGCCTGCAGCAATCCTTTGATAAGATCCGAGAACTTCTCGCGATACTGGGGCGGC
ACCTTGCGCACTCGCTGGGCGATTGGCTTCGCGTCGCCGACGTCGATGTCGCACACCGCCCCAACCGCTGCGGGGGGCAGGGCATTGCCCATGCCGATCA
GCAGGTGCTAGTACTTCCAGATCTCTTCCGCCAGTCGCTGGATCTCCCCCGGAGTGTTGGTCGCCGGATCTCCCACTTGCAAGTCTTCGATCTTCACCTC
GATCGTCGTGGCCGTAACCTCGGGCAACACTGCCAACTCCTTCTCGAGATCTTCTGCGTGTAGATCGCCACTCTCGTGCAGATACACTGCGTCGTCCTCC
GCGCGATCTCCACTGGAGCTTGAAGCCATCTCGCTGGATCCAGGATCCTGTTGGGCGGTCGGTGCCGGCACGGCGGATCCGCCTAGGTCCGCTCCAGCAT
CACTCGACACCTTCCGGCAGGACTCATCAGCAGCGTCTTCATCTGGGGCTGCTGTAGCACTTGGTCGGTCTTCCGCGGGGGCTTCCGTCTTCTCTCCGCA
CGTCATCAGGCTTGGGCACTGCTGGTCGCGGTCCTTGGGATCCCTTGGTACGTCTGACGGCGGCTCCTGCGTCGCCCCTGGGCCTTCGGCGTCCACACCA
TCGTCTTCCCCACCTCGAGGCACATCAGGAGCACCTTGGTTGCGCGCGTAGAGAGCCCTTGGCGCGCTTGTAGCTGCAGCGCCCTTCCTGCAGCGGGTAG
CTGCTGCTCGCTCGGCGTTCAGTAAGTGTGAGCGTATCAGGTCCCCGCTAAGTCCGGAATCAGACGGACGACTGGCCGACTTGTCCTTTCCTTGGTCCGT
GTCGCACGTGACACGCTGATCTTCCGGCAGATCCGGCGGCACAGTCGACTTTGCATGTAGACCTCGTAGAGAAGCGTGGGGCGCACCGTTGGAAAGCCCT
TGTCCAGACACGTACGTTGGTTCGACTCCCAGCGCCTGGGCATTCCTGGGATCTTCAGGGCGCTCAGCGACGTCGCCCGTGACTGTGCCACCTGAATGAT
GGTCGCCACATGTCAGATGATTATGCGACCCTTCGGCACTCTCGCCCTGTCTCTGAACAGAGACGGGGCACCCAGGCGTATCTTCTATGGGCGGTGTCAG
CGTAGATTCCTTGGCTTCCTTGGCTTCCAGGCATCGGATCGGGGCGTGCGGTGGCTCTTCGTGCTCGCCGCTCGTAGCTCTGCAGGTATCTTTAGCTCCG
GTCCGTGGATCTGGCTCCGTGAGGGGGATGGCTCGCTGGCGCGCCTGAGTAATGGTCACTGTCGGTCGCCAGTGACGACCGTCTAGCTTCAACACTGGCG
CGGTGCACAGAGCCTGGGTGTGGTGCACAGCGTTGACACGCGCCACCGCCGTTGGATCAGGTCTCTTCAGTAGCGCCTTGGGCTCCGGGTACGCCGGGCG
ATCCACCGCCGGCTCCAGCTCCCAGGGCTCCTTCGGCCGCGTAGGCGGCGGAAAATCGGTCGTGGCGCTCGCGGCGAGGTTCTGCCACTCGTTGTAGCTC
CGCGACCCGACGGAGCTGAAGCCTGGGGTGCGCGGGACGTGGTCGCCGGCCAGCCACATGCCGATCTCCTCGTTATGGTTCAAGGTGATGGCGGACTCGC
CGATGTTGGTAAGTTGCAGATAGCGGATCTTGCCTGGGCCTTGCACTAACGTCGGTACCCATTGCTTGCCTCTCCGCAGCCACAGCTTCTCGTACTCCTT
GAGGCGGATCCAGTCTGGATGCTCGAACGTGTCGCCGGGATCCAGCCGCACGCCTTCCTGGAGCAGCAAGGGCCGGGTTCGGCCGCTGAAGATCTGGCGC
CGCCCGTGAAGCCGGATCCGGATCTCGTCGTGCAACCACACGGATCCGTCGTCCAAGTCGAGTCGGATCCCAGCCGGGACCATGAAGTCCATGCCGAGGA
TCGCGTCGCAGTCTGGTGGAAGATCCTCGCCGACCCACACGTCGCAGAAGTACACCAAGTACCCGGCCAAGGTAACCTTGATCCTTGTTCTGCCTGCTGC
AACGTACAATTGCTCACCAATTCCGAGGCATTCTTGTGTTTGACTAGTGTCGATGTGGGATCCTACCTTACGAGCAAAGGCGGCGTCGATGATCGACATC
TCAGATCCCGAGTCAAGAAGCACGGTGGACTTGGCATTGTTGATCTTGCACGTTGCCTTGGCCTGCTTGAAGTGCTTGCTGGGGACATGGTACTTCCAAT
ACCCGCGCGACTCCCCGGGCATCAGATCCAAGGCCATGGCGACCTCGGATCGTTGATTCTCGTCAGCAGGGCGAAAGCTTGCAACTTTAGCCGTACGTTT
CCCATGTAGCTCACGTGTATTATCAAATAGATCCGCTTGCTTGACGCTAACTTGATCCATTGACTTCTTGTTCACATATGCATAGATGTATGACGTAGAA
CGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCAGCAGCCTCTGGAAGCATGTGCTTGGCAGGATCAAATCACTGGCG
GATGAGGTTGTAGAACTCCTCCAGCTGGCACTTGCCTTGATCGTGGAGCTCGCCGCAGCCTCGGCAGACGAAGAAGCAGCGATCCGACGGGTGGCCTCTC
TTGCCACACTTCTGGCAGGTCAGGCGCTTCCAGCAGCCAAGATCCGAGTGTTTCCGGGATCCGCAATGCGTACAACGCTGTCCGTCGTTGGAGTAGCGAG
GTCGGCGATCCTGTGGCAGTGGGTCCGCGTTGGTTTGAGCCGGCGTCTTAGGATCCGAGGCTCCAGTCGCTTCCTTGGCCGTGGCAGCTTGCTGCTGGTC
GTTCAACGACGCGACATACTCCCGGCGCAGCTCAACTTCGGATCC