Description :
From Genome Similarity Track
Location :
Scaffold_511:6933- 9974
Sequence
3041 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCATAAACATGTTGGATGATGAAGGGAATGACTTCCATCCCACGCATGTAAGCTACTCCCA
TTTGAGTCAAATCGAATCGGATGCTGTCGAACGTTTGAGCTCGACGATAAGGCAAGAAGCCGTCGGCGCAATGCTGTCCTCTCTGAGGCCAGACGGACAA
CACGCCACCATTACCAAGTTCATCCAGAATGAACTTGACGCTGAACGGAAAACGTTAACCTTGCTTCATCAACAAGGGTCTCAACAGACAGAGCTGTTGA
GAGAACATAGTGCTCAACAGTTTAAACTGTTGAAACAGCAGCATGCCGCTGCTATCGGGTCGACACACACCCGTCGACCCGAAACATTGAAGATTGACAT
CTTCAAGTACAAGGGAGACGATGAAGACTCCCTGTTGATATGGTTTGTGAAGCTGGACGATACTATAAGGGCTCTTCACATAGTCGATGAGCACATGCAG
GTGGCATTTCCTCAATAGAACTTGGCAGGAAGTGCGAAGACTTGTGCCTTAGGCCTCAAGCTACACGATCCATATGTCTTTGGGTCGTTAGAAGTCTTCA
AATTCCGGCTCAGACAAACATTCGAGCCACCGCGAGCTGAGTTCAGGGTTCGCTCTGAACTCCTGAAACACAGACTAGGCAAACGTGATGTACATTCATA
AATTCAGTACATACGTCAACTTACGAGTTGCAGTACAGCAAATACGATGAATGAACAAACGTTGATCATGTTGTTCATGCGGGGTCTCACAGACGGTCCA
ATCAGGACCTATCTCTTCCGACTGGAATTCGATACCCTGGAAAAGGCAATCCGGGTTGCGGAACAAGAAGATTTCAGTGTGAAACAAGCTCACGTGAATT
CGAACCCCTATTGTCCCCCGAGACGTTGGGAAAGTGGAGGCCCAGAGCCAATGGACCTCTCTTACGCTGAGAGTGAAAGCTCTCGCATTACTAATTTTAA
AAAATTGCAGACATACATAGCTGTCAAAAGCCAGGGCATTATGCCTATGAATGCAGTGCCCCGAACGCGGTACCACGTACCGCAGGAAACAGTAACCGTC
AAGCGGCCAAGAAGGGTCCGAGGCGTGGGTCCGACGCTGTTGCGAAAGGGTAACACCGTAACGGACAGCCAAAAACGGTCAGGGTCAGTAGGTGCGGAGC
AGGCCCGGCAACGTCAAGTGAATTCGCACGCCTCTTGACGAGAGTCGCCCCCAACACGCAAATATTGTGTGTTACTGCATCTGGTAATGAGGTTTTCCTC
ATTACCACGAAGCTCGAAGTGGAAAAATACATGTCACTTCGAGCCCTAGTCGATTGTGGGGTGTAGAACAACTTTGTTGGGCGCCAGTCTCTAGACAATA
GCAAGCTTAAACTTATTGAGCGCGAGATCCCTCCAACGAGGATAACGGTACGCCTCGCTACAGGCGCATCCGTAACAATGATGGAACGTGTAGTGAAAAT
TACCTATACACTGAGAGAAGTCCAATATGGTGATGACTTCATCGTATTGGACTTGAATGAAAAAATTGATTTTATCCTTGGTTTACCGTGGCTCAGAAGG
TACAACCCACAATTCAGCTGGCATCGACGAACAGTTGATATGCCTGTCGCTTGTTCACCAGATGGACATCTGATGAACGGCATGGAGCGACCACTAGCAT
GTGGGTGTACTACGGGTGAGTGCGAGGGCCTCACGTATTTTTTTGTTTGGTCGTTATTACGACTGCACATGACCACAATGTAACTGATCATCACATTGTG
GAGCAAGATTCCGGTGATTGCGTAGAAACGCAGGTAACGCCGAAGGCCCACCACCCGAATGAGCCGAGCGGACCGGAGCATGGAGTTTTTTTAAACGGTC
AACACCCAATCAACACTAAACCGATTGCCAATGATTCGCAATACGATGATCTTAGATCGATTGGAGAATTGCACGTAGAAGGCCTGGCCGCGGTAGCGCA
ATCACCGCCAGAAGACTTTGAGGGAATAAGTCCACTCGTACTTGATGATCATGTCGCCCAAGAGGCTAGTGAGGGAATAAGTCCTCAATCAACTGAAATA
AATTATCAGAAGACAACATAGACATTGAATGGCCTGGTAAATGACGGATCAAGTATAGGTGATATCTAGAAACTTGATCTAATCGCGCCTCCGAAGTCAA
CTTCGGAGATCACTCAATTGCCCACCCTAGGACAGAAGAGGTTCTTGCATGATCTTCGTAGAGGAAAATCAAGCCGATCTGCGTACTCGTTCCACAGGAC
GAGTATGTCACCGATATCTGGTCGGCAATGTTCTTTGCCGAGAATGAAGGGTTCTCAGCAGCTCATGAATGGACGAGAGTTTCTTTGGTGGGAAGACACG
AATTAAGAGATATATAAATCTCAGTCGTGGGAATCTCTCTGGGCAAATCCTTTTTACGATGATTAGATTGAACCTAGGGATGCTTCCCCAGAAGTAGTGC
CGTGCGAGTTACCTAAGGATAAGGGTACTCGTCACGCAATCGGCCTGAAAACGGGGGTCGAAGTATGAAGCAGTTGCCAATGCCCCGTAAATAAGTACTA
GCGGTCGACAAACTCTTTACCGATCGTTCAGCAGCGGGTCATGCGAGACGGTCAACCTCTCCACCAAGACTCTCCGAACTTTTGTGTGCGAAAGTCCATT
GGAGATTGGCGGATAGTACACGCCTTCAACAAGATGAATGCTGCCACTTTACCGGCTCAAACACCAATACCAAGGGAAAGGTGTCATCATAGATGGTATG
GCTAAGAGTACCATCTTTTCATCCATGGATCTGATGGATAGGTTCTATCAGATCCTTATGCCGGAAAGAGACATTCCCTGTACTGCAGTGAGCACCTAAA
GTGGTATTCATTGGGAGTGGTTAGTAATGCTACAAGGGCTAAGTAATGTACCTGCCACATTCAATAGATGTGTAATGAATCTATTAAGATCCGTAAGAGA
GCTCGCGCCCAGCTACTTCGATGATGTGTTCGTCCATAGCC