Description :
From Genome Similarity Track
Location :
Scaffold_3405:693- 1817
Transcript NameFunction/comments
Phyta_totarag15268reverse transcriptase

Sequence
1124 bases(100 bases per row)
TCCACGGCTGGGCCTGGACGAGGAATACGCGGAGCCGGGCTCCGTGAATGGAAGAATAGACAGCgcatgcagaagaagctgcgcgaggcTCGGTCCGGGA
CCGAGACAGTAAACCAGATGTCTGCCAGGTAGACATCAGACCCGACGTCAAGCGTCGAGACATTGCATGTCTTGACGCAGACCCGTACTGGGTTACAGTA
CAGGAGTATGACTCTGGAGAACCCTCCGACGAGTGCGTCGGAGTCGACGTCGCTTCCAGTCATgtgctggaagcgcttcgcACGCGACTTGCACGATGGa
cgcatcgagcagatctGCATCCTTTCAGACAAGGAAAGGTTGAAGTGTGAGGCGGAAGAGTTGAAACAACTCTTCGCTGGCAGTACCACTGAGAGTGAGG
ACACtctcagcgccaagacgaagaaNATGCGACGATACCGGCACAGACGCCGATACCGCGAAAAGATGTGATCATCGATTCTCTGGATCGACTGCTTGCC
GGTGGCGGAGctcgccatcaacaactcgGTGCATGCTTCGGCTGGGCATACACCGTTCTAGGTGAACGCCATGCGACATCCACGCCAGCCGAACGTGCTC
GGGGCGGTGGCTTCCTCCTTAAGTGGGGGAGGAGCTACGGCTGCAAACCAGCAACCGCAGCAAACAACTGATACATCCACAGTATCAGTTGCAACTATGG
ACACGAACACCGTGTCTGTGCCGGGCACAGATACCGCTAAGAAACACGCACAGGCCGGATGTGATAGGCTTGTCACAGTCTGTCCCATGTCCCACGTCAC
CGTTTCCTAGAACGGTGGCCAATCAGATCCCGTTGTAGATTAGTGGTTGGAACGGTCTGGAGCGCCGAGACCGTCTCGACAGTTAAGTACAGAGTCTAAT
CTACCATCAAATTTCCTCACTGTGCTTGTGTAAGCCGGTAACAGTATTAGCCCGTTACACCGGGCCTGTAGCGGAAGACGTATTCGAGCTGAACAAGTCA
TTCAGCTCGGAAGTAATGGACTTTGTCCAACGCAGGCAAGCCGCCATCCGGTTTGTCCATGATGCTattgcagcttctgctgatcggcagaagctgaacg
cagCCAACGTTGGCAGGGGCAACA