Description :
From Genome Similarity Track
Location :
Scaffold_2864:693- 1728
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_2864-snap-gene-0.1Gene of unknown function

Sequence
1035 bases(100 bases per row)
ATCACGTTCGTGCTGTTACACTACCCCCGGCTGAAGTAGGAACGTCAGGACAGCCCGGCGGTTAGGCGCCTCGAGGTGTGTGTGCTCGAGGCGCATTGCT
CACTTGCTGATCTGCCCGCATGGTCGACTCATCTCGTCGCGGCACGAACGGCTCCTGCGCATAATGAGGCGCGCCAGCACGAGGTAGAACTCGAAAAAAC
TGAAGAGTAAATGATCATTTGACATCAAGCTACCGTGATCGATCACCTAATGGACCTAGCCAAGCGGCAAGGCCAGCGCTTGGGTGCACTCGAGGCGCTC
GTGAACACAGGAGCGCATTGGCAACGCAAACGCGCGATGGTAGAACGCGGCGGCGATAGCTCCCTGGCGAAGCGGCGACAGTGTCCTCCGGCGACGTCGC
TGAGGGCGACGTGGTATGACTGATACTGCCGCGAGCCGCGTCTTTGGGATGCACAAGGTGAGAAGTAGCGCAAGCCAGACGTAAAGATGACCGCAGCGTA
TATGAAGCTGTTCCTTGCAGCCTTCGTTCTTCGTGAGGATGACGCGGCGTACCATGACGCGGTAATGTCGCTGGGTGAAACGGCAGAGCGGAACACCGTC
ACCTTCCTCACGCAACACAAGATCTCGGTGAAGAGATCGCAGTCTGTGCTGAAGCACATGCGCGCTCTTCACAAGACTGGCGAGTTGAATGACTTGGTCG
AAGAGCACAAGCGTCGTCTCGCTGCAGGAGTCATCGTCGATCCAGCTCTGCGCCACACCCATGGCGTGCTCAAGTCTGTAGCAGTGGGATCAGCAGAGCA
GATTACACGTCAGCCTATTCGTACATCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGGTTTGCAGTTGTGCTGGGGCCT
GCTGTTGTGTGTACAAGCTTGTTCGGATGCGCTCGCTTGCATGTCGTCGGGTGAGCTCGCTCGCATGTCGTCGCATGCGCTCGTTTGCTTGTCGTCGCAT
TCGATCATCGACACTAGCACTCGCCCGGCGGTCGT