Description :
From Genome Similarity Track
Location :
Scaffold_32:692888- 693933
Sequence
1045 bases(100 bases per row)
TCCTTGCGAAAGTCCTAACTCATACGAGTCTCGAGACACCTTCTTTAGTATCAGGAAAGGTCTAAAAATTTCGGAGATAACTTCTTCGACTGTGCATACC
CCTTGTGGCGGATGTCCATGTTCTTTCCGTCAAGTAACACCATATCACCAGTCTCGAAGTCTTGGACAAGTCTGTTCCTGTCGTAATAGTGTTTCATGCG
TTCTTGGGCTTCACTCATACGGTCTTGTGCTACCTTGAGGAAGACCTCTTGCCGGAGTAAGAACTCTGTTGCTGCTTTCTCCAACTTGTTGAATATCGGA
TCTAACGAAACCTCGTCGGGCATGTACGGAATATACCCAAGATCCGCTTCAAACGGTGTCATTCCGATCGTCGAGTGCACACGTCGATTGTAGGCAAACT
CTGCCATATGAAGAAACTCATCCCAATCGTTCTGGGCTGGGTTCACGACTCCACGAAGATAATCCCCGATAAAACGGTTCGTACGTTCCGTTTGTCCATC
CGTCTGTGGTCTAAATGCCGATGACAGGTAATGCTGCGTTCCCATAGCAGATATAGCAGCCTGCCAAAACTTGGACGTAAATTTGGAGTCACGATCAGAC
ACAATCGTCTTCGGAAGGCCATGATCTTTTACATAGTTCTTCATGAAGACATGCGCGGTATCTTCTGCGCTATCTGTCGTCTGCGTTGCAATGAACTTTG
CACGCTTGGTCAATCGATCCACGATGACCACGATGGCATTACAACCATCCTTGCTGGGAGGTAAGGACACAATGAAACCCATCGAAATGTCGATCCATCT
ACCTCTTGGTACTTCCAGCGGTTGAAGTAATCCCGGCGGTTTCACTTGTCTCGCCTTGTTGCGCTGACACATTTCACAAGTGTTGCAATAACGCTGGATA
TACTTCATCATCTTCGGCCAATAATACTTCTCTCGTACTGCGACGTAAGTCTTGTACGATCCAGGATGGCCTGCCGTTACGGCATCGTGGTTCTCGCAAA
TGACACGGTCTCTCAGATCTTCGTCATCCGGAATATACAGTCGCG