Description :
From Genome Similarity Track
Location :
Scaffold_122:69288- 70534
Transcript NameFunction/comments
Aphin_H310_13644tau-tubulin kinase, putative

Sequence
1246 bases(100 bases per row)
ATGTCGGCCTCTCTTCGCCGCTGCAGCGACTCGACCTTTTTCCTCTGCTCGGCCTGCCGGCGCTCTCCGTACGACTGGATCGTCGGCGGCAGCACCGACA
ACGTTTGCGTTTTCAGTCGTTTTTCCACTTTCCAAATGTGCTCCTGCATCTTGAATCGATCGGGCGCGTCCTCTAGCCCAAAGAATGACCCGTAGTGCTT
GGCAACCTTGAGCAGCATGTCGTCGTCCATGACGCCTTGCTTCAGCGCCTTGACCCACTTGGCCGCGCGATCCTTGGTGTCCCGGAGGGCGTCCCACTCG
TGCAGCAGACTCGCCTCGTCGTTCACGTCCTCGACGGCCTTGATTGCCTTGCGGATGTAGCTGTAGTTGGGCACGTCGCCGTACCCGAGCGTCTTGAGGT
ACTCCATGATCGCGAGGAGGTGGCGCGCGCCCGGCAGCCCCTCCACCATCTGCTCGGGGTGCTGCTCCGTGAAGTACTCCTTGAGCTCAACGACGACCTC
TCGGTTCTTCTTTTGGGCGTCGTGGGCCCACGGGAGTTCGCCGCGCACAAAGTCGAGGACGAGATACATCCACGACCATAAATCGTCGCGCCGACCAAGA
TCTTCGCGGCGATGTGCCTGGAGCGACGCGTACATGGACGTGCCACGGAATTCAGCTTTGTCGCGCGGTGGAATCGGCGCGCCTTGCGGGTCCAGGTGCT
GCTTGGACAGCCCAAAGTCAATGATAAAGTAGCGTCTACGCACGGTCAGTTGCGTGAGCCCAGCACCACGTGGTCACGCCGGATCGATGCGCACGCACGT
ACTTTGGGTCCTTGCCGTTCGACAGCGCAAAGTTGGACGCCTTGATGTCGCGGTGGATGAACCCAGCATGGTGGAACGACTCGAGGCAGTCGAGCATTTG
AATTGCCGCCGACACGCACTTGGTCAACGGGACGCCGTGGACCGCGTCTGGCTGCTGGCGAATTTTCGACATGTTGTCGCCGAGCAACTCCATGACCAGG
ATGAAATTCTCGCCATGTTTGCCGTGGTGGTGATACTTGCACACGTATGGACTCTTGCGTTGCAGTGCCACAAGCACTTGGCTTTCCCATTCCAGCACGG
GCTTCATCTGGCTCGGCGCCTCGACCTTGACAGCAACTCGGTGTGACGAGTTTGTCATGTCGGACGCTGTGTAGATTTGACTGAACGTGCCCTCGCCGAT
TTTCTCCACGACACGCCATCGATTGAGCAGAATTTCGCCATTCTAT