Description :
From Genome Similarity Track
Location :
contig_2:692753- 694363
Transcript NameFunction/comments
g601.t1hypothetical protein

Sequence
1610 bases(100 bases per row)
TTGATGGAATTGCAGGTCAAGTCAGCCACGCTGTTAGTTTTCAGCGCAGATGGAACTAGAATTCGGGAAGAGAGAATTGTGCCGATTGAGCTCGTCCAGC
GTGGGGATGTATTAAAGGTTGTTCGTGGTTCGTCAGTTCCGGCAGATGGTGTCATCATGTACGGCGAAGGTCGTATTGATGAGTCGATGTTGACGGGCGA
ATCCAAGACAATCAAGAAAGCCACTGGCGACCGCGTATTGGGGGCAACGGTAAACGTCGATGGTTTGTTTCACATGAAGGTTACTGGTGTGGACAACGAC
ACGGCGTTGAGCCAGATCATTCGTCTTGTTGAAGATGCGCAGACCTCAAAAGCGCCGATCCAAGCTTATGCAGACTACGTTGCCTCCATTTTTGTTCCGA
CGGTGCTGGGGCTGTCGTTCTTGACATTTTCAGCGTGGTACGTTCTGTGCGTGTTTGAGATTTTCCCCGAAAGCTGGATTCCGCACACGGACAGCACGTT
CGTGTTTGCTTTCAACTTTGGCATTGCAACCCTAGTAGTTGCTTGCCCCTGTGCTCTGGGATTAGCTACGCCAACGGCAGTCATGGTCGGAACGGGTGTT
GGTGCAGAGCACGGTGTATTGATCAAGGGTGGAGAGCCCCTCCAGGCTGCACACAACGTCAATACGATTCTTTTCGACAAGACTGGAACGCTAACCGTGG
GCAAGCCTGTGGTGACGGATGTTGTAGTGCTAAGCAAGAAGCTGAGCACTGAAGAGCTGATTATTCTGGCGGGGTCGGCTGAACTCGGCAGTGAACACCC
GCTGAGTAAGGCAATCATCGAGTACGCGAAGTTCATCTCGTCGTCTCTCGAGCAGCCGACAGGTTTCCGAGGCGTTTCTGGAAGAGGCATTGCGTGTATG
GTGGGGGAACGTAAGGTCGTAATCGGCAACAAGGAGTGGATGGCAGATAACGGGTTGAAGCGTTTGACCAGCATTGTGCTGCAGCAAGCCACTTTTACCT
TTCAAAATGCCGGGAAGACGACAATCTACATGGGCGTCGACGATGAGCTCAGCGCTGTATTTGGTGTGGCCGATGCTCCGCGTAAGGAGTCGATCCGTAC
GCTGAAGAAGCTGAAACAGATGGGGTTGGAGGTCTGGATGGTCACCGGTGACAACGCGCGTACCGCGTTCACCATTGCAGATCAACTTGGAATCAGCCGT
CGTAATGTCATGGCTGAGGTGGTTCCGTCTCAAAAGTCCTCAAAGGTCAAGCAACTCCAGAGCACCGGTCGCATCGTTGCCATGGTGGGCGACGGTATCA
ACGACTCGCCTGCCCTTGCACAAGCTGATCTGGGTATCGCTATCGGCGGTGGCACTGAGATCGCTGTGGAGACGGCCGGCATGGTTCTCATGAAGGCGAA
CCTGTTCGACGTCATTACTGCGCTGGACTTGTCTCGGACGATCTTCAACCGCATCCGGCTGAACTACGTGTGGTCACTGGGCTACAACTGTCTGCTGATC
CCTTTAGCCGCAGGTGTGCTCTACCCCTTCGGCTTCAGCATCCCGCCCATGTTCGCTGGCGGCGCCATGGCCATCTCGTCCGTGTCGGTGGTCACGTCTT
CGCTCTTGCT