Description :
From Genome Similarity Track
Location :
Scaffold_279:6926- 12760
Transcript NameFunction/comments
Physo_144842pol protein

Sequence
5834 bases(100 bases per row)
GAAGATTGAGCGTGTACGCAAGGCCCTTCTTGGCCACAACCTTGAAAGGTCCGATGAAGCGCGGGTGCAACTTCGTCTTGAAGACGGCAGACACTGCATG
TGTAGGTAGGCTCTTAGCATTAAGCAGCACCAGGTCCCCGACCTCATAACTTTCAACATTGCCTCTGGCCCTGGCATCTGCATGTTCCATTTGTTTGTCT
TGGCTCTCAGCCATTGCGTCACGCACGTGTCGTAAGACACTCAGACGCGTCGACAAGAAAGCGTCAACCTGTTTACGAACAGTAGCCGAGCTGACATCGG
CTAGCCGATCAGCTAAATCGGCTTCTCCTCCCCCACCAAGCCCGAGGCCACCACGTGGCGGCGTCAGCGGGACGCGGGGATGAGACAAGCTGTTCACGTA
GAATGGCGTGTAGCCTGTCGAGGTGTGCACGGCGTTGTTCAACGCAAACTCAACGAGTGGCAGCATGGCGCTCCAGCGCTTCGGCGTCTCGGCGCAAATG
CTGCGGAGCACGTCCTCGACGACGCGATTCACGCGCTCTGTCTGACCATCGGTCTGCGGATGGTCCGCCGTGGACATGTCCAGCTTGGTGCCAAGCACCG
CAAAGACCGCGCTCCAGAAGTTGCCCGTGAAGCGGGGGTCTCGGTCCGAGACAATCGACTCAGGGAGTCCGTGTTGTCGAAACACTCGGTCCAAGAACAG
CGTTGCTGTACCTTTACCATTGATGGTATCCGGCACAGCCGCAATGTGAGCCATCTTGCTCAGTCGGTCCACGAAGACCACGACTCCTGTGTTGCCGGCC
GCGTCCGCCGGCAGGCCAAACACAAATTCCATACTCATGGATTGCCAACAGCCCGAAGGGACAGGAAAACTCGCCAACGGCGCGGCAGCATGAGGTGACG
ACTTCACTCGCTGACACGTCTCGCACGTGCGCACGTAAGTGCTCGTCCACTTATACATCTTCGGCCACCAGTAGTGGGTGCTCCCCGAGCTGTAGGTCCT
CTCACGGCCAAGATGGCCGGCCAGCGGCGTGTCGTGTGCCTCATAGAGGATGCGAAACTTCAGATCCTCATCATGAGGGATGACCACGCGGGGCGTATCC
TCGGGGCCGGTGTTGTAGAACAACAGGCCTCCATCGAGGGAATAACGGTGTAGTCGCGCGCGCAGCCGCGCTGACAATTTCATGTCCGAGTCTTGAAACT
CCTTGCTCCCCAGAGCCTTCAGCAACGCGACACAAGTGTCGTCCTTGGCATAAGCCGTTCGGATCAAATCCGGTAATGACGAAGTCACGGTCGTTACATG
AGCCAGCTCAGAATCCGGCCTGCGCGACAGCGCGTCCGCGAGGATATTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCGCGAAGAAGGAC
AGCCAGCGGGCCATCCTTTGCGAGAGATGAAGCGACTGAGTCGCAGTGCGTAACGACGCATGATCCGTGTAAATCACGAACGGCTAAGAGCCCAACAGGT
GCACCCTGAACTTGACGAGCGCATACTTCATTGCAAGTAGCTCCTTGTCGTGGACAGGATAGTTCTTTTCCGTAGCCTTCAGCTGGCGAGATTCGAACGC
CACCACGCGCTCGCGCCCCTCGGCGTCTGCTTGCAGCAGGGCACAGTCGATGGCAAAGTCCGAGGCGTCACAGACGACACTAAACGGACGAGCGGGGTCT
GGCAAAGCCAGAGTAGGCGCATGAAGGAGACTGTCCTTAATTGCCGCAAACGCATCTTGATGCTCGGTGTCCCAACACCACTCCGCATCCTTCTTCAGGA
GATTGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGCCAAGCCACTTGCGAAGATCCTTCTGGTTCTTGGG
AACCGGCCAGTCAACAATGGCCTTGACCTTGACCGGGTCGGCCCTCAGGCCACGCTTCCCGATGAAGCACCCTAAGAAGGGGATCTCTTCCGCTCCGAAG
ATGCATTTGTCAATGTTGGCGTACAACTTGTTTTGACGCATGCATTCGAGCACAGCACGCAGGTGCTCCACATGGTTCTCCATATCAGTCTTTCCGTGCT
CCGCACGACTGTGGACAAAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATGGGGCCTGAAGAGCTGCGTCACAAGACGATTAAACGTCGCTGGCGC
GTTCGAAAGCCATTGGGGCATCACCAACCACTCCCAGAGCATGCCGCTCGGTGTACTCACCGCAGTGAGAGGAATGTCGCTCGTCCTCATGAGCAATTGG
TAATACCCATCGACCAAGTCGAGCGCACTGTACATCGTACATCCTGTCATGTTGTTCTGAAGAACATCCTTCTGAGGGATCGGCGTCTGCGCCGGAATGG
TAGCGGCATTCAGCTTGTTGAAAGCATGCACGATACACCACTTGCCATTCGGCTTTCTGACACAGAACGTCGGCGTAGAGGGTGGAGACTTACTCTCACA
CACCATGCCCGCCTCGTGCTTCGCACGGAAGAACGCATCAATGACGTCACACTGCTCCTTCGGCAAGGACCACTGCCTCGTCACACAGTACTTCGTTCCC
GGAACGAGATCGATTCCGTGTCGAACACCTCGATCCGGAGGTAGCCCCGAGGGCGGCTCCTTCGAAACCCCGTCCTGGTAATCCTTTACCACTTGATACA
AGGGATCCGACGGGTCCTTCAGGATCGCCGATCCGCTCCGCGCATTCAGCGCCTTCTTGGTGTCTTCCAGGACAGCTTCATCCAGAAGCGAGGACGAGTT
CAACTCTTCTTCGGGTCGTATGACCACTACCTCGGCCAAGTCTCCAGCCTTCAAGGCTTCGCCGAACTCGGCCAAGGACATCTCGTCCAGCTCCAGGAGA
GCAGACAGTGAGGGCAAGTCGTCGAGGTTGATACCTCCGTCGACGTCGCCCGTCACTCCATTCACGAGTGTATAGAGCTGCTCGCTCTCGCGTGGAGCCT
CGCCGCTCGACACGCCCTTCTCGACTCGTGAGATCGCAGACGCCTTGCGTCTCGCAGCCAGCGCTTTGCGGCGCTGCCTCCTCTTCATGGACACCGTCCG
CCCTGAAGAGCTCCGTGATTTCGCGTGCGTCTTGACGCCAGGTGTCACCACCTCGTTCAGCTCCGGGGGAGCTCCAGTGTCTTTACCGACACTCAGCGAA
GAGCTGCACGATCCGCAGCCTCCACACAGTGGATTACGTGCCACTCCACGATCTTCATCCGGGCAAAGCCCCTTGTTCTTCGGCATCGTGCCGACCGCGC
CGTCGCTGGCACGCAGCAGGGCGTCGTCCTCAGACGCACGCCCGCTCAGCGGAATTAGTGCCGCTCCACATCCTTGATCCGGGCAACGCCCATCGTCACT
CGACTTCCTGTCGACCGCGCCTTCACCGGCACGCAACAGGGCGTCGCCCTCAGACGCACGCCCGCTCAGCGGAATTAGTGCCGCTCCACCTGCCGTCCGC
GAGCCACGCTCGGAACGCTCGTTCTCGACACACTCAGTGTCCACCAACTCGGAAACTCCGATGTTCAGCACATTGACCGACTCGGTCCAGTGCTCGCGCC
AAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGCTCATGACTCGCCAATGCTCCGCCAGGAGAGAAGTGCGTAGCACCAAGGGTCTTCGACCTCCAATCGAT
CCAAGGCTCGTGGCGTTCCAGCCACGCCATTCCAAGGATGAGATCATATCTCGAATCGAGATCTAAGACCAGACAGCGTTCCACGCTATCAAAATCCAAA
AACTTCACGCCCAGGTCCACAGGGACCTTAGGCACCGTGACACGAGTGCCCGTCGCGAGACGAACAGTGACGATGTCACTCCCGCGCGCTACCAGCGCCT
CAGCATAAAGCTGACTTCCGTCCATCGTAGAACGCCGGGCGTAGTTACCCGACGCTCCCGAATCGATCAAAATCGTCCATGGCTTGGTGAAGCCCTTCAC
CCAAGCTCAATAGAACTTAGTTCTTCCCCAGTAAGCCGCCCCGCGCCTACTGGGACTTCTCGTTTCCCCGAGACAAACCAGAGCCCTGGCTCGAACTCGA
AGAGCGGCTTGACGAAGCCTGGCGCTGATGGCGCAGCGGACACCCAGCACGAAGGTGACGGGTGTCACCACAGATGAAACATCTGCGGATACCGCGACGC
TGCTCAGCAGCACGAAGCTCGGCTTCTTCGTCTTCAGCATAGCTGAGGTCCATGGGTTCCGGACCACTCGACGCGCTAGCGTAAGACGCGCTCCACCCAA
GTCTCGATGGCTTAAAGTTGTGTTCCGCATTCAATGCGACGCTCACAGCCTCTTCAAAAGAGCTCGGGTGGGTTCGGAACGCCTCCGTCCTGGCAACGCC
AGTGCGAAGACCTTCCATGAACACCGTAACGGTGACTGCTTCCGGCAGTGGGTCCGCCGACATGCTAGCAATGAGAGTTCTCAACTCTTGGACATAGTCC
ACCAACTCCTTCTTGCTCTGCCGAGTAGCCAGGAAGCGTGAGCGCACGCGATACGCCTCGTTAGGCGGAGCGAACACCCGGGACAATTGCTGTTTCAGCT
GGTCCCACGTCGGGAAGGCCACCTCGACCGACGTCCCGGACGTTAGTGCCCACTGTCTCGCTCGCCCACCGAGCTTCGAGATAGCTAGTGCCACGCGCTG
CGACTCCGTCCGAAGTAGAGCTGAGCTCATAGCCATCTCAACCTCACGGGTCCAAAGCATCAAGCTTTCACCCTCCTTGCCTTCGAAGGTCTTCACGCTC
AACATGAGCGGCTTGGGTCTTGTTCCCACGTCGGATGGCGAAGCGGGCGCTTGGGGCGGAGCGGCCGTTGCCATCCTCTGCTGGAGGTGCTCTAGCAGAG
CATTCTCGTAGCTTGAAAACGCCTCGAGACGCGCAGTCACCGCGTCGGGGCCTTGATGCGCAAGTTGCGTTACACCCTCCGGGCCTAGCAAAGACATGAG
CTTTTTAAGCGCATCCTGCTGGTTCGGGGGCAAGTGAGCGAACTGCTCCATTCTCCACAGAGGGTCAAGCTATACAGACTCAGGTGTCGGATTGACTACA
AGAGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTAACAGACTCACAGAGTCTCGGCTTAAGATAGCCCGTTCTAATACCAG
AACGTACGAGTCCGTACACCTTACGGACTCCAAGAGTCAACCCTTAACTCTTAACTGTGTGAATCTCAAACTGAATATATTTCCCTTTATTGCGGCAAAG
CCGCCTACGGTGTAAATGTATCCGGTTCACTATCTAGCATAGTGAACCCTAGTCATATGCATAATCAGTGGCTCTGAAGCCATGTACTGATTCTCCTACT
GATTTAGGTTAGACAGTGTCTACCCACTTCATAACCCTTCGGGTAACTCTTGTGTAACCCCGTTACAGTTTACTACCACCCAAGTTGATTTTACTTGCAC
ATTCACGTACACATCGTTTTTGCTACTGTCTAATGAGATGACTGGCCGCAGCGCGGCACGGTCACTGGCCAACATGTACGATGTATTTAGCACTCAAATT
TGCTGTTAGCGTATGACAATTGTCGTATCCAGCAAAATGTCATACAGTTGAATCTATCCAATCAGATTCAAGTATTTTGTCAGGGCGCAATCACTCGAAA
AGCAATTGTTGTATCCGACTCCAATCTGGTGTTTATCAATTCTGTAACGGAGTTACTTGCAAGTGTACCCTGTGGGTATGGTACAGTGTACCTCATGGCC
TATGGGCCAGTCATCTGCATATAAGTTCCGGATC