Description :
From Genome Similarity Track
Location :
scaffold_970:6925- 9025
Sequence
2100 bases(100 bases per row)
TTTACATTTTTACTTTTCGATGTAAAAAAGCACTTTTACTCGAATAAAACATTTTTAAGGAAAGATTTTACATTGTTGACGTAAAAATATATAATTGACG
CTCTGTGCTCACTTCAACACACTTCTAACGCACTTTCGATTTATACATCACTTCAGAACCTACATGATTGACTGCACTCCACTGCTGTGGCTTGCGTTTT
AGCTTGTGGTATTGTCACCAATGGAGTTTCTGCGTGATGATGATCCTAACCCTCGTAAACGTGGGTGCCGTCCAGGCTCTCTCCACTCGCACTTTACTCG
TACGAAGGAGATGTGCAATAAGGGTATGTGGTGGACGGTGTGTAGATATTGCTCTTGAGCTCATGTTAATGATCCAACAAGCGTTCCAGTGGTTTACGTG
TGGGGAGGAGGGAGGCGTGGGAGAAGCATTTGTCTACTATGGAAGGAGTTGGTAGTATCGGACGCGGTGAGATAAATCCTGGTGGAGCAGGCGCGAATAG
AAATCTCAACAAAGAGCAACGCGCATTGCCACCCGAGTTCTCGTCAGCTGAGAAGAGGGTATTTTGACGTTTGTTGCTAGAGTACCAAGCGGAAGCCCTG
CTACCCGACTCATTTGTCGAGCTTGTGTCATTTAAGAGGTTGACCGCGTTTTTAAATGCTTGCTGTGAGGAATCGGGTGCTATACCACGCCGGCAGGTGT
TAGGTAGTTGGGTATTGAATGAGTACGCTAATATTCACTCAGCTGAGCAACGAGACGACGCCAAGGCATCAAACTGATAGTAGCGCAAATTTTCTGTCCG
ATGTGTGGGAACTACAGCAAAACTTCACGTACTAGGATGTCAATTAGCCATATTTGGGCATGCTATGACCTACGGTTTGAGACCAGTCGGGGATCACCAC
GATGGGCTTGCGCTAGCTGAACAAATAGAGACAGCGATAGAAAAACGATTGAAGTTGGGGTGAAATGTGGGAAGTGTTGTGACTGATAATGCTAGGCAAT
CGTCGAATTTTAGTCCTTCCTTACCCTACTATTTCCTTCCCGAAATGCTTTGCTCATGATACAAACAATCTTGTCAAGAACGCTCTGGAGGCAGTCTTTA
AAACGACATCTGAAGAAGCTGCAGTTGCTGCTAGCTTTCTTAGTACTTGTACGTCAAGTTGTTGGTACGTGCGCAGCAGTCCATGATGGCTCGTTGTGGT
GACGAGTTTGCTGTTTTTACGCTATGTGAAACGCGGTGGAATTCGATGCATGCGTGCTTGCGTCGCTTTTACGAGCCCGATGTGCATTTGAAGATATGAC
CTTTACGTATCGAAATAGCAACGAGCTCCCACGAAAACTTCGCATTCTGGGAGATACTGACTTTTGGCTTAGGTTGGAAAATGCTGAGAGAACTATCCGA
CCACTGTGTACAGCCTCCTTTCGCCTTCAAAGAGACGAAAACACTGTTGCTGACGTCGTAATTTCTTATCTGGATATTTTGTTTCGACAGAGTGGAGCGA
CGGAATGCCTGCGAACGATCATTGTCCATTTTGGGGTTATTTCTGCATCCTGTACACGTAAGTGAAACACGGGAATTATCTTCAATCATACTGACTGGCC
TAGATGACGTGTGCCAATTTGTGATGTATTACTATCTTCGCTTAATCCTTTCGTTCTCAAAACGATACATAAAGTAGTTTTTACAAAAAAGGTACAAGAC
AAGATATGGCAATACGGAAATCCAGAGGCGTTATTCATACGCCAAAACGAAACAGAATGGCACTTGAAAAGCTAATGAAGCTTCAAGTAATGCGTAAGTA
CGTTCATGATAAACTTCGCATCGAAAGACGGTTTCATCTAGCGCAAAGCAGTTGCTTCGAACTATCGACCCATGGGAACGACCGTGTATTTAAACGCCCT
AGCACTCTACACAGGTTATACCTGTTCAGCCAGCAGCACCACCATCTCAAAGTTCTGCTCAACGGCATCGAGAGGTTCAAGTGACACCAGATCGTGCTTC
ACCGGGTCGCACTCCACTAGGCCTAGGCCGCGCTACATCTGGGCGTGCTACACCTGAGAGTGTCACGCCTGTACGCTTCACACCAGTGCGTTCCACACCC