Description :
From Genome Similarity Track
Location :
Scaffold_1584:6925- 8628
Transcript NameFunction/comments
Phyta_totarag13297reverse transcriptase

Sequence
1703 bases(100 bases per row)
TTGGCCCTTCAGCCAACGGTAGcggatctgctcgagctcgaagagctgtcgtACATCGCGTTTATCGACTCGCTGAAGGCGGGCGAGCTTGAGGAGTTGG
TACTCATTCGTCGTGAACACGACTCAGTGGAATTCAACACCTCTTCGGTCATGGACCCCGACATGTTAGAAGACGAGCGGTCTTCGTGGAGACACAGGGG
CTATGGAGCTGCGGTCCTGAAGGACCCCTCGGATCTATATCATTCCCTTTTGAAGGACTTCTCTGACGTGGCCAATGATAACCCACCGTCGGTGTTACCA
CCGGATAGGGGCGTCCGACACGAAATTGATCTGGCACCCGGTACCAAGTACTGCACCACACGCCAATGGCCGTTGCCGAAGGAGCAGGTCGATGTgatcg
acttcttcttcgccaccaAGTATGCCGCTGACATGGTGCGCGAATCTAACTCGCCACAATCGTCGCCGATGTTCTGTGTGCGTAAGCCCAACGGGAAGTG
GCACGTGATGAATGCTTTCAAAAAGTTGAACGCAGCTACAATCCCGGCGTCGACGCCAATCCCTCAGAAGGACGTGTTGCAAAACAACATGGCGGGTTGC
ACCCTCTTCAGCGCACTCGACATGGTCGACGGCTATTACCAGTTGTTGATGCGCGAGTCAGATATCCCCCTCACCGCGGTGAGCACTCCCAGTGGGATGG
CAAGTCATGCCGCACGGGCTGacgaacgcagcagcaacgttcaATAGGCTGGTAAATCAGCTCTTTCGGCCGATGCGGCAGTTTGTAGAGACGTACTTCG
ACTACATCTTCGTGCACAGTCGAGCCGAGTACGGCAAGACGGCCGTCGAGATTCACATTGAGCATCTCCGGGAGGTTTTGATGTGCATGCGCGAGAATCG
CTTGTATGTGACATCAACAAGTGCATCTTCGGTGCTGACGATATCCCATTCTTGGGCTGTTTCCTTGGGAAGGATGGCGTTCGTACCGACCCGGAGAAGG
TGTGCGCGATCGCACAATGGCCGGTGCCAACATCCCAGAAGGACTTGCGCATGTGGCTTGGCTTGGCCAACTACCTGCACAAGTACAGCGCCAACTACGC
AGAGATGGCGCGGCCGCTCACGAANTCGATGCCGAAGGCAGGGAGCGGGTAGTCTCCTTTCAGTCACGCCAGCTCAAAGCGGCTGAGAAGAACTATCCTG
TCCAAGACATGGAACTTCTCACAATGAAGTACCCACTTGTGAAGTTCAGGCATCATCTGCTGGGCAGCAAACCCCTCGTGATCTATACCGATCACGCTTC
CTTGAGGACAGCGACTTCGTCGCCACACCTCTCCCAGCACATGGTGCGATGGCTTTCCTTCTTCGCGGAATACAACTTCACCGTGGCGTACAAGCCTGGC
NGCGACGAGCCCCGCATTGTTGTGCCGCACAACGAGGACCTGAAGCACCGAATCCTTTATAAGGCTCATGATACCCCGCTGAGCGGACATCTCGGTCGAA
AGAAGACATACACGTCTGTGGCATGCGGGTTCTGGTGGCCCCACATGTACAAGTGGGTCCGGAACTATGTACAGACGTGCGAGACGTGCCAACGTGTGAA
GCCGGCTCTCTCAATGTCAGCCCGGCTGATAAGCCTGCTGGTGCCGGTCGACTGCTGGCGCTCCGTGAGCATGGATTTCATCTTCGAGCTACCGCCCGAC
GTC