Description :
From Genome Similarity Track
Location :
Scaffold_1636:6925- 8003
Transcript NameFunction/comments
Phyta_totarag13396hypothetical protein

Sequence
1078 bases(100 bases per row)
GGTAGTGGCCCATGATCGATTTCGCCATATTCGATGGGATCATGAGACGAGCGAGTTCGTTTGCTGAAAGCGAGTCAGCTTCCATATCGCCATCTGCGGT
CTGGCGTAAGATCAGCGAGTTAGCGCTTATGACGGCTGTTCGATTCTTGAAGACATTGCACCACTATGACAGCACACATGAACTGGTACAAAtcatcttg
ttgctgttctccACCGGCGATGTGGAAATCACGGTCCCATGCCACATAATTGATCGAACGTAGTTCTTCAGTTGGTTGGATTTGGTATAGCACTCCACGA
GGTTTGAACTGCGAAAATTTTTTTGGCTTTACGAGCACCTTGATGTCGATGGTTTGTTCCGCTTGGATACCGACCACAAACTTGCCAATTTGTAGTTCGT
TgttggagctgtcgtcgcagAAAATTCATAAATCCAACCCAATCGTGAGGTAATCTCCCACATCCATCACAGCTTTGGCAACCAAATTGAGGGTCTTCAC
AAGTTTCCACTGCAATTGCGTGGCACTTTTAAAAAGAGCTTCGCTtccagcatcatcatcaatTTCGAAAGAGATAGCCCATCTCAACTTAACCAGGACT
GCGTTAAAGTTGCGGTGCCACGCTTGCGAAATGGAGTCCGCAATCACGAAGACGGGTAAGTCATCCGTGTACAGTCGGTAGTAAATCTCACTAAAGCTCT
CGGCCTGCATCCACTGCGGTGGAACCGCTCCATTTGCTACTGGTTTCGTCTTCTCATCGGGCGTCAAACGGAACTCAAACTGCTTCAGTAGTTGGCGGCG
TCAGGACACCATGACAAGGTGTCATTGACACCCCGCACGTAGTCGTCTCCATCAAGCTTCCGAGCCTCTGAGCGTTTTTTCTCCATCTCAACTTGCACCG
AATCAACATCGAACAAATCGAAGAATTGTTCACTGCTCCAGTATAATATATAGTACTTGCTATCTGTTGATGTCGAAGAAAGAGAAGGATATTCCGCGTC
GCCAATGTCGCCTTCACCCATagtgttcttcttgttggtgTGCTTTGACTTCTTCACTCTGAagcaaattggagaatg